TABLE 1.
Bacterial strains, plasmids, and primers used in this study
| Strain(s), plasmid(s), or primer | Descriptiona | Reference or source |
|---|---|---|
| Strains | ||
| S. epidermidis | ||
| NCTC 11047 WT | Nasal isolate; Aap+ | |
| NCTC 11047 Fib+ | Subpopulation; Aap+ | 3 |
| NCTC 11047 Fib− | Subpopulation; Aap− | 3 |
| RP62A | Intravenous catheter isolate; Aap+ | 7 |
| JBN3, JBN8, JBN9, and JBN10 | Nasal isolates; Aap+ | This study |
| JBJ1, JBJ4, and JBJ5 | Joint infection isolates; Aap+ | This study |
| JBC7, JBC9, and JBC13 | Catheter infection isolates; Aap+ | This study |
| JBS4, JBS5, and JBS14 | Skin isolates; Aap+ | This study |
| L. lactis MG1363 | Surrogate host for Aap expression | 17 |
| S. gordonii DL1 (NCTC 7868) | Intermediate cloning host | |
| Plasmids | ||
| pUB1000 | L. lactis cell wall expression vector carrying erythromycin resistance | 24 |
| pUB100aap6high | pUB1000 carrying the aap gene with 6 B repeats giving a high level of expression | This study |
| pUB1000aap6highT | pUB1000 carrying a truncated version of aap6 with no A domain giving a high level of expression | This study |
| pUB1000aap2, pUB1000aap4, pUB1000aap5, pUB1000aap6, and pUB1000aap7 | pUB1000 carrying aap genes with 2, 4, 5, 6, or 7 B repeats giving a lower level of expression | This study |
| Primers | ||
| 16SR | 16S RNA gene sequencing of S. epidermidis isolates (CCGTCAATTCGTTT CAGTTT) | 34 |
| raap157-857F | Cloning region of short repeats within the A domain (CCGGGATCCGCAG AAGAAAAACAAGTTGATC) | 43 |
| raap157-857R | Cloning region of short repeats within the A domain (CGGAAGCTTGATAG TTGGAACATTCGGTGCTTC) | This study |
| aapFSalI | Cloning of aap into pUB1000 (TACGCTGTCGACCCAATTACACAAG CTAATCAAAATGATAG) | This study |
| aapRBamHI | Cloning of aap into pUB1000 (TGTCGGATCCAAATTATTTTT CATTACCTTTTTTACGACG) | This study |
| pUB1000F | Sequencing of aap inserts (CCGTTGTCAGGTGTTTACGCT) | This study |
| pUB1000R | Sequencing of aap inserts (CTTTTGGTGTCTCAGGTTTGT) | This study |
| aapTFSalI | Cloning of truncated aap into pUB1000 (TACGCTGTCGACAGAGCTGA TTTAGATGGTGC) | This study |
| aapTRSalI | Cloning of truncated aap into pUB1000 (TACGCTGTCGACAGCGTAAA CACCTG) | This study |
| Aap53-608 r.c. | Checking size of the B region (CATTGACATACACTCCTAAGC) | 43 |
| aapR | Checking size of the B region (CCAAATATGAACAATGATCCG) | This study |
a
Aap+ and Aap− indicate strains that express or do not express the Aap protein, respectively. Underlining in primer sequences indicates restriction sites.