. Author manuscript; available in PMC: 2010 Dec 14.

Published in final edited form as: J Infect Dis. 2009 Dec 15;200(12):1901–1906. doi: 10.1086/648474

TABLE 2.

Primers and conditions used for PCR reactions.

Name	Location^*	Size (bp)	Primers Sequence (5’-3’)	PCR conditions
Chromosome 18	1259[7]	149	CTTAATGAAAACAATGCCAGAGC	35 cycles of 94°C (30s), 51°C (30s), 72°C (1m)
Chromosome 18	1259[7]	149	TGCAAAATGTGGAATAATCTGG	35 cycles of 94°C (30s), 51°C (30s), 72°C (1m)
HSV-1	U_L30[6]	345	CCAACACAGACAGGGAAAAG	35 cycles of 94°C (30s), 52°C (30s), 72°C (1m)
		345	GGAACATGCTGTTCGACCAG	35 cycles of 94°C (30s), 52°C (30s), 72°C (1m)
		196	CAGACAGCAAAAATCCCCTGAG	25 cycles of 94°C (30s), 48°C (30s), 72°C (1m)
		196	ACGAGGGAAAACAATAAGG	25 cycles of 94°C (30s), 48°C (30s), 72°C (1m)
HSV-2	U_S6[9]	285	AGGCCTACCAACAGGGCGTG	35 cycles of 94°C (30s), 58°C (30s), 72°C (1m)
		285	CCTGGATCGACGGGATGTGC	35 cycles of 94°C (30s), 58°C (30s), 72°C (1m)
		210	CACCGTCGCCCTATACAGCTT	25 cycles of 94°C (30s), 56°C (30s), 72°C (1m)
		210	ATCGACGGGATGTGCCAGTTT	25 cycles of 94°C (30s), 56°C (30s), 72°C (1m)
VZV	ORF29[6]	271	ACGGGTCTTGCCGGAGCTGGTAT	35 cycles of 94°C (30s), 55°C (30s), 72°C (1m)
		271	AATGCCGTGACCACCAAGTATATT	35 cycles of 94°C (30s), 55°C (30s), 72°C (1m)
		207	TTCTGGCTCTAATCCAAGGCG	25 cycles of 94°C (30s), 49°C (30s), 72°C (1m)
		207	ACTCACTACCAGTCATTTCT	25 cycles of 94°C (30s), 49°C (30s), 72°C (1m)

Reference numbers for primers are included in brackets.

HSV-1 and VZV PCR amplifications were performed in triplicate and all HSV-2 reactions were done in duplicate. Primers specifically amplified sequences within the DNA polymerase gene in the unique long (U_L) segment of HSV-1, the open reading frame (ORF) 29 in the VZV genome, and the glycoprotein D gene in the unique short (U_S) segment of HSV-2.