Skip to main content
. 2009 Nov 16;10:525. doi: 10.1186/1471-2164-10-525

Table 5.

Primers used in the analysis of cell-wall-degrading enzymes

Primers Sequence (5' to 3') Use
Eng1-0F CTCTACGGGATGAAGTGTCT In situ hybridization, amplification of cDNA and gDNA of Aa-eng-1 and Aa-eng-2
Eng1-0R TTAACAAAAGCGGTACAAG In situ hybridization, amplification of cDNA and gDNA of Aa-eng-1 and Aa-eng-2
Eng1-1F GCTCAAGGTCGTCGTCGAGG Sequencing of cDNA and gDNA of Aa-eng-1 and Aa-eng-2
Eng1-10F GGCATCTCCGAGGCCGACG Sequencing of gDNA of Aa-eng-1 and Aa-eng-2
Eng1-10R CTTGCCGTACTCCTGCGCGAT Sequencing of gDNA of Aa-eng-1 and Aa-eng-2
Eng2-20R GCTACTTTGCTGGTCCACGT Sequencing of gDNA of Aa-eng-2
Pel1-0F TCCGACGACAACGTCAACCA In situ hybridization, amplification of cDNA and gDNA of Aa-Pel-1
Pe11-0R AAACCCTCAGCATGTTTGATAC In situ hybridization, amplification of cDNA and gDNA of Aa-Pel-1
Pel1-1F TCGAGAACGTCTGGTGGGA Sequencing of cDNA and gDNA of Aa-Pel-1 and Aa-Pel-2
Pe11-10F CTTGGAGGTACGCTTCGTACG Sequencing of gDNA of Aa-Pel-1
Pe11-10R TGACCTTCTTCGCCGCAGTG Sequencing of gDNA of Aa-Pel-1
Pe11-20F GAAATGGTACGATTAGTCCTG Sequencing of gDNA of Aa-Pel-1
Pe12-0F TCAGTCGGACAGCTTTTCCTC Amplification of cDNA and gDNA of Aa-Pel-2
Pe12-0R AGCAGGCATTTCGTCGACAC Amplification of cDNA and gDNA of Aa-Pel-2
Pe12-10F CGAGATGGCACGGGTGCCGA Sequencing of gDNA of Aa-Pel-2
Pe12-10R CGTAGCGAGAAATTTTCGATCA Sequencing of gDNA of Aa-Pel-2