TABLE 2.
Primers used in this study
| Primer | Sequence (5′-3′)a | Application | Source or reference |
|---|---|---|---|
| ComE-BamHI-3′ | CGGGATCCATTTCTTCGAAGAC | Deletion of comE | This study |
| ComD-5′-2 | GCAAACCGGAATTAACTCAGGTG | Deletion of comE | This study |
| ComE-BamHI-5′ | ACTGTTGACAAAGCGGGATCCACTGG | Deletion of comE | This study |
| ComE-3′ | CCAAGTTCTTTATCTTGTTCTTG | Deletion of comE | This study |
| ComE-3′-3 | GGACTTCCTGTCGTCTC | Deletion of comD | This study |
| ComD-BamHI-5′ | GAAGTAGGATCCTCAACAAAAGG | Deletion of comD | This study |
| ComD-5′ | CCCTACCTCATCAATTAATGCG | Deletion of comD | This study |
| ComD-BamHI-3′ | GAGCGAACGGATCCACCAGTAACTTGC | Deletion of comD | This study |
| Pcom-BamHI-5′ | GGCAGTCCTTATCATAAAGGATCCTTGACGC | Cloning of comDE into pDL278 | This study |
| ComE-SphI-3′ | CCAGTTTATCTCGCATGCTCAACAG | Cloning of comDE into pDL278 | This study |
| CiaR-5′-1 | GTCGGCTTGCTTGGTGGATATACATTCGG | Deletion of ciaR | This study |
| CiaR-BamHI-3′ | CATCTTGGGATCCTCCTGCTATAAGATAC | Deletion of ciaR | This study |
| CiaH-3′-2 | GATTCTGACTGGTTTGCTCC | Deletion of ciaR | This study |
| CiaR-BamHI-5′ | GATCGGATCCGGGGCTTTGACAG | Deletion of ciaR | This study |
| CiaH-BamHI-5′ | TGGTGCTGGTACTATTGGGATCCCATAT | Deletion of ciaH | This study |
| CiaH-3′ | CCCAGATTCTGCTATCGCACCCACC | Deletion of ciaH | This study |
| CiaH-BamHI-3′ | GTG TGAATACACCAGGATCCCG | Deletion of ciaH | This study |
| CiaR-5′-2 | GATGACTTTGCGGATGTCATGCAGGT | Deletion of ciaH | This study |
| Pcia-HindIII-5′ | AGGATAGCTATTCTAGTCAAGCTTATGAAG | Cloning of comDE into pDL278 | This study |
| CiaH-SalI-3′ | GCCAGCCATATGTCGACCCAATAGTACCA | Cloning of comDE into pDL278 | This study |
| VicR-5′-1 | GATGGTCGTGAAGCTCTTGA | Deletion of vicK | This study |
| VicR-BamHI-3′ | GGCGAGGATCCCTTCGATTCTC | Deletion of vicK | This study |
| VicK-BamHI-5′ | GGAGGATCCCTGGGAAAGTGAAG | Deletion of vicK | This study |
| VicK-3′ | CCGATAAAATTGTGGTGCCGCCGC | Deletion of vicK | This study |
| VicR-5′-2 | CAAGGGTGCCTTCCCAACATGGC | Deletion of vicR | This study |
| VicR-BamHI-3′-2 | GCCGGATCCACTTCATAGCCC TC | Deletion of vicR | This study |
| VicR-BamHI-5′ | CTCGTCGTGGATCCGGCTAC | Deletion of vicR | This study |
| VicR-3′ | GAACAGCTACCAAACCAGAG | Deletion of vicR | This study |
| Pvic-BamHI-5′ | GCTATCCTAGCGGATCCCGCCAAC | Cloning of comDE into pDL278 | This study |
| Vic-SphI-3′ | TACCACTGCATGCAGATGC | Cloning of comDE into pDL278 | This study |
| Flp-5′ | CCAGTTTTATATGCCGTA | Deletion of flp | 14 |
| FlP-3′ | GTCCAGTAGACTAACTTTCT | Deletion of flp | 14 |
| Flp-SmaI-S | TCTTTTTTTCTGGAGACCCGGGTGATCGCCTT | Deletion of flp | 14 |
| Flp-SmaI-AS | GAGAAAAAGGCGATCACCCGGGTCTCCAG | Deletion of flp | 14 |
a
Boldfacing indicates engineered restriction sites.