TABLE 1.
Strain, plasmid, or gene | Relevant characteristics or primer sequencesa | Reference |
---|---|---|
S. meliloti | ||
1021 | SU47 str-21 (wild type) Smr | 23 |
10OtSS | 1021 (ΔotsA::Sm/Sp) Smr Spr | This work |
10MOTK | 1021 (ΔtreY::Km) Smr Kmr | This work |
10treS | 1021 (treS::pSUP202Pol4) Smr Tcr | This work |
10OtM | 10OtSS (ΔtreY::Km) Smr Spr Kmr | This work |
10treSY | 10treS (ΔtreY::Km) Smr Tcr Kmr | This work |
10trOt | 10treS (ΔotsA::Sm/Sp) Smr Tcr Spr | This work |
10SYOt | 10treSY (ΔotsA::Sm/Sp) Smr Kmr Tcr Spr | This work |
E. coli | ||
DH5α | supE44 ΔlacU169 φ80 lacZΔM recA1 endA1 gyrA96 thi-1 relA1 5hsdR171 | Bethesda Research Laboratories |
S17-1 | thi pro recA hsdR hsdM Rp4Tc::Mu Km::Tn7 Tpr Smr Spr | 33 |
Plasmids | ||
pBSKS(+) | Cloning vector; Apr | Stratagene |
pGEM-T Easy | Cloning vector; Apr | Promega |
pHP45Ω | Plasmid containing Sm/Sp cassette; Apr Smr Spr | 29 |
pHP45 Ω-Km | Plasmid containing Km cassette; Apr Kmr | 9 |
pK18mobsacB | Suicide plasmid; Kmr | 32 |
pSUP202Pol4 | Suicide plasmid; Tcr | 11 |
pGUS3 | Plasmid containing nfeD::gus fusion; Kmr | 13 |
p53Gus | Plasmid containing uidA gene; Gmr | L. Girard (CCG, Mexico) |
p53otsA | p53Gus derivative containing a otsA::gus fusion; Gmr | This work |
p53treY | p53Gus derivative containing a treY::gus fusion; Gmr | This work |
p53treS | P53Gus derivative containing a treS::gus fusion; Gmr | This work |
pJB3Tc19 | Plasmid RK2 derivative; Tcr Apr | 2 |
pJB3otsA | pJB3Tc19 derivative containing a PCR-amplified fragment with the otsA gene from S. meliloti 1021; Tcr | Our laboratory |
pJB3treY | pJB3Tc19 derivative containing a PCR-amplified fragment with the treY gene from S. meliloti 1021; Tcr | Our laboratory |
pJB3treS | pJB3Tc19 derivative containing a PCR-amplified fragment with the treS gene from S. meliloti 1021; Tcr | Our laboratory |
Genes | ||
otsA (SMa0322) | TTATCTAGAGCAGGTCCATGGTTTCGATA/TAATCTAGAGAAATCTAGTCACTCTGGACACb | This work |
treY (SMb20574) | TAAGGATCCGTCGAAGACGTGCTTGAAGA/TAAGGTACCACGCTCGAATGGCTGATCCT | This work |
treS (SMb20099) | TAATCTAGACGTCTGCTTTTTCGCTACAT/TAATCTAGACCGACATTGTGGAGGTAGAT | This work |
Smr, streptomycin resistance; Kmr, kanamycin resistance; Spr, spectinomycin resistance; Gmr, gentamicin resistance; Tpr, trimethoprim resistance; Apr, ampicillin resistance; Tcr, tetracycline resistance.
Forward/reverse primer sequences (5′-3′) are shown. Underlined are the endonuclease XbaI action sites used to clone the mutated gene versions into the shuttle vector.