FIG. 3.
Effect of CAML depletion on HIV-1 particle release and surface expression of Tetherin in nonpermissive HeLa cells. (A) HeLa cells were transfected with nontargeting siRNA (siGENOME control siRNA [catalog no. D-001210-02-20; Dharmacon]; lanes 1 to 3) or specific siRNA against CAML (siGENOME SMART pool [catalog no. M-011601-01; Dharmacon]; lanes 4 to 6). Subsequently, cells were mock transfected (M; lanes 1 and 4) or transfected with the proviral plasmid HxBH10vpu_wt (wt; lanes 2 and 5) or HxBH10vpu− (−; lanes 3 and 6). Cells and supernatants containing viral particles were harvested 24 h posttransfection, and lysates were analyzed by Western blotting. Cell lysates were analyzed to detect Gag products, Vpu, and β-actin by using specific antibodies. Virus lysates were analyzed for the presence of p24 by using anti-p24 antibodies. Depletion of CAML mRNA was confirmed by RT-PCR using CAML mRNA-specific primers (forward primer, 5′ GGTGATTCAGTCAGTACAGG 3′; reverse primer, 5′ CTGACTCCAAGAGCAAGAAG 3′); as a control, actin mRNA levels were analyzed by RT-PCR using actin-specific primers (forward primer, 5′ACTCCTGCTTGCTGATCCAC 3′; reverse primer, 5′ TGGCTACAGCTTCACCACC 3′). (B) Quantification of virus particle release efficiency. (Top) Densitometric quantification of HIV-1 particle release efficiency after endogenous hCAML depletion. Virus release efficiency was evaluated as described in the legend to Fig. 1B. The virion-associated p24 signals were evaluated using longer blot exposure times to reveal the bands associated with HxBH10vpu−. (Bottom) The levels of released infectious virus were evaluated using HeLa-TZM indicator cells as described in the legend to Fig. 1B. For both panels, the release efficiency of HxBH10vpu_wt was arbitrarily set at 100%. Error bars indicate the standard deviations of the means of results from two independent experiments. (C) Tetherin cell surface expression was measured by flow cytometry as described in the legend to Fig. 2. The levels of surface expression of Tetherin by HeLa cells transfected with nontargeting siRNA (solid-line histogram) were compared to the levels of expression by HeLa cells transfected with specific siRNA against CAML (dashed-line histogram). As a negative control, unstained HeLa cells transfected with nontargeting siRNA were included (gray-filled histogram). Mean fluorescence intensity (MFI) values are indicated for each sample.