Table 1.
Primers Used for Reverse Transcription Real-Time Polymerase Chain Reaction Determination of Transcript Levels
| Transcript | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) | Amplicon (bp) | PrimerBank ID |
| Cat | ttgccgttcggttctccac | gaaaataggggtgttgtttccca | 134 | 6753272a3 |
| Sod1 | aaccagttgtgttgtcaggac | ccaccatgtttcttagagtgagg | 139 | 12805215a1 |
| Sod2 | acaaacctgagccctaagggt | gaaccttggactcccacagac | 128 | 31980762a3 |
| Prdx6 | cgccagagtttgccaagag | tccgtgggtgtttcaccattg | 115 | 6671549a1 |
| Gpx1 | ccgtgcaatcagttcggaca | tcacttcgcacttctcaaacaat | 124 | 6680075a3 |
| Gpx4 | tctgtgtaaatggggacgatg | acgcagccgttcttatcaat | 130 | |
| Txnrd1 | gcagtactgagtggcgtt | tgtgagggagcctcgtg | 107 | |
| Gclc | cgatgtctgagttcaacactgt | ggaatgaagtgatggtgcagag | 105 | 33468897a3 |
| Gclm | aggagcttcgggactgtatcc | gggacatggtgcattccaaaa | 105 | 6680019a1 |
| Gsta1+2 | tattatgtcccccagaccaaaga | cctgttgcccacaaggtagtc | 128 | 7110611a3 |
| Gsta3 | aaaccaggaaccgttacttccc | ttcaaccagggcaatatcagc | 107 | 31981724a3 |
| Gstm1 | agcaccacctggatggag | agtcagggttgtaacagagcat | 111 | |
| Aor | aggagggcgacaggatgat | ccaacctaataaagccgctaca | 101 | 13385466a2 |
| Akr1b3 | tgcggtgaaccagatcgag | ccaaggggactatatgctgtca | 102 | 31981909a3 |
| Akr1b7 | ccaatactgtcaatccaagggc | aatctccattactacggggtctt | 103 | 6753148a3 |
| Akr1b8 | agggcatctctgtcactgc | gctgaggttttctcgtgcttg | 130 | 6679791a2 |
| Rps3 | ttacaccaaccaggacagaaatc | tggacaactgcggtcaactc | 100 | 6755372a2 |
Notes: Primer sequences were from PrimerBank (30) (http://pga.mgh.harvard.edu/primerbank) except for primer sets for Gstm1, Txnrd1 and Gpx4, which were designed by us. The gene names are Cat = catalase; Sod1 = superoxide dismutase 1; Sod2 = superoxide dismutase 2; Prdx2 = peroxiredoxin 6; Gpx1 = glutathione peroxidase 1; Gpx4 = glutathione peroxidase 4 (mitochondrial phospholipid hydroperoxide glutathione peroxidase Phgpx); Txnrd1 = thioredoxin reductase 1 (the primer set recognizes the four known splice variants NM_001042523, NM_001042513, NM_015762, and NM_001042514); Gclc = glutamate–cysteine ligase, catalytic subunit; Gclm = glutamate–cysteine ligase, modifier subunit; Gsta1 and Gsta2 = glutathione transferase A1 and A2, respectively (complementary DNA derived from both genes is recognized by the primer set); Gsta3 = glutathione transferase A3; Gstm1 = glutathione transferase M1; Aor = alkenal/one oxidoreductase (also known as prostaglandin reductase Ptgr1 or leukotriene B4 12-hydroxydehydrogenase Ltb4dh) (31–33); Akr1b3 = aldo-keto reductase family 1, member B3; Akr1b7 = aldo-keto reductase family 1, member B7; Akr1b8 = aldo-keto reductase family 1, member B8; Rps3 = ribosomal protein S3.