Table 1.

Nucleotide sequence and characteristics of the primers used for PRNP genotyping

Primer	Positions	Orientation	Nucleotide sequence 5′-3′	Genotype	Tm (°C)	G + C (%)	Length (bp)
1	25819–25834	Forward	GGCCTTGGCGGCTACA	M129	57.8	69	16
2	25820–25834	Forward	GCCTTGGCGGCTACG	V129	55.8	73	15
3	25981–26004	Reverse	CTTGATTGTGATATTGACGCAGTC	D178	57.5	42	24
4	25981–26004	Reverse	CTTGATTGTGATATTGACGCAGTT	N178	57.0	38	24
5	26047–26068	Reverse	CCATCATCTTAACGTCGGTCTC	E200	57.3	50	22
6	26047–26068	Reverse	CCATCATCTTAACGTCGGTCTT	K200	56.9	45	22

The polymorphic and mutated bases are in bold and underlined, respectively.