Skip to main content
. 2009 Dec 30;9:277. doi: 10.1186/1471-2180-9-277

Table 2.

Diversity in the PbGP43 polyadenilation cleavage sites, which are also indicated (bold and italics) in the sequence below.

Cleavage sites P. brasiliensis isolates
1 2 3 4 5 7 8 10 12 14 clones/site base

1420 1 1 G

1423 4 5 2 1 2 14 C

1425 1 1 C*

1427 1 1 3 1 6 T

1429 1 1 C*

1430 1 1 1 3 T

1434 5 1 1 2 1 10 T

1439 1 1 2 1 5 G

1441 1 1 1 3 C

1451 1 1 1 1 4 C

1453 1 1 2 C*

1454 3 1 4 T

1457 1 1 2 T

Total amplicons 6 4 4 5 8 6 4 5 10 4 56

1330tgggactttttacggcttggagcgtaggagaacagctgattatttacgtttacatgtttaacttttattaagaaatggaaaggcttaattgaacacttactaattaattgacattgtttttcactactatccatttgtat 1470

* after this base there is a different base from A