Table 1.
PCR Primer and hydrolysis probe sequences for the five human total RNA targets.
| Target (Length) | NCBI Accession Number | Transcript length (nt) | primer and Probe Information | |||
|---|---|---|---|---|---|---|
| primer/probe type | Sequence (5'-3') | 5' position | Limit of detection | |||
|
PBGD (265 bp) |
NM_000190.3 | 1526 | Forward primer | GAGTGATTCGCGTGGGTACC | 213 | n.d. |
| Reverse primer | GGCTCCGATGGTGAAGCC | 476 | ||||
| Hydrolysis probe | - | - | ||||
|
ABCA5 (82 bp) |
NM_172232.2 | 8177 | Forward primer | GGCTGCTATTCTGACCACTCACTATA | 4598 | < 7.6E+01 copies |
| Reverse primer | TTAACTGCCCAGACACCATGAT | 4659 | ||||
| Hydrolysis probe | 6 FAM - CAGAGGCTGTCTGTGATCGAGTAGC - BHQ1 | 4633 | ||||
|
ABCA6 (114 bp) |
NM_080284.2 | 5296 | Forward primer | CCATGAGAAATGTCCAGTTTCCT | 324 | <1.6E+01 copies |
| Reverse primer | TGCTGGGTTAAATTAGATATTGGTGTA | 412 | ||||
| Hydrolysis probe | Alexa Fluor®647-TCCTCAGAATCTGGGAAGGGTAGATAAA-BHQ2 | 355 | ||||
|
ABCA7 (147 bp) |
NM_019112.3 | 6832 | Forward primer | TTTCTCTGGGACATGTGTAACTACTTG | 4981 | <8.9E+01 copies |
| Reverse primer | TGTGATCGACCAGCCATACAG | 5104 | ||||
| Hydrolysis probe | HEX C6-NH- CCTTCCAGCAGAGGGCATATGTG - BHQ1 | 5042 | ||||
|
ABCA10 (61 bp) |
NM_033450.2 | 5118 | Forward primer | GCGGGTTAAGCTTGTGACAGA | 1601 | n.d |
| Reverse primer | CCCACCCGCAGAACTTGA | 1645 | ||||
| Hydrolysis probe | - | - | ||||
To complement the PCR primer and hydrolysis probe sequences, this table also includes the NCBI Accession Number, the amplicon length, the transcript length, the position along the transcript of the primers/probes, and the lowest limit of detection for each of the RNA standards (ABCA5, ABCA6, and ABCA7).