Table 1.

Primers and endonucleases for genotyping of IL-10 promoter single nucleotide polymorphisms

SNPs	Primers	PCR conditions	Restriction endonucleases
-1082A/G	F:ACACAAATCCAAGACAACACTACTAAGGCTTCCTTGGGA	3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 56°C, 40 seconds at 72°C, then 10 minutes at 72°C	XagI
	R:GTGATCAAACAGAGGCACAGACAT
-819T/C	F:CACTCTAAGGCTTCCTTGGGA	3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 56°C, 40 seconds at 72°C, then 10 minutes at 72°C	Hin1α
	R:CCTACCGTCTCTATTTTATAGTGAGCAAACTGAGGCACAGACAT
-592 A/C	F:AGCTGAAGAGGTGGAAACATGTG	3 minutes at 94°C followed by 35 cycles of 40 seconds at 94°C, 45 seconds at 63°C, 40 seconds at 72°C, then 10 minutes at 72°C	Rsa I
	R:TGGGTTCTCATTCGCGTGTT