Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences for QT-PCR
| Gene | Forward | Reverse | Gene bank No. | Source |
|---|---|---|---|---|
| OCT2 | gtggctgcaggtcactgtta | caggtctgaggctctgaagg | AY028623 | Canine |
| OCT3 | aggacctggctgtggtattg | ccaaatccgtgctttgtttt | NM_11395 | Canine |
| beta-actin | actgggacgacatggagaag | acatacatggctggggtgtt | AF021873 | Canine |
| bcrp1 | agcagcaaggaaagatccaa | cccatcacaacgtcatcttg | AF140218 | Murine |
