Table 2. VNTR markers and their differences between Schu S4 and NE061598.
| VNTRa Marker | Repeat motif | Repeat size (nt)b | Genomic Location | Repeat copy no., strain SCHU S4 | Repeat copy no., strain NE061598 |
| Ft-M1 | AAT | 3 | I (−76) | 3 | 3 |
| Ft-M2 | TAAATA | 6 | G (+12) | 4 | 5 |
| Ft-M3 | AATAAGGAT | 9 | G (+1401) | 25 | 20 |
| Ft-M4 | TTGTT | 5 | G (+55) | 3 | 3 |
| Ft-M5 | TTTCTACAAATATCTT | 16 | I (−21) | 3 | 2 |
| Ft-M6 | TTGGTGAACTTTCTTGCTCTT | 21 | G (+1160) | 4 | 5 |
| Ft-M7 | TTTCTACAAATATCTT | 16 | I (−21) | 4 | 4 |
| Ft-M8 | TTTCTACAAATATCTT | 16 | I (−21) | 4 | 4 |
| Ft-M9 | TTTCTACAAATATCTT | 16 | I (−21) | 4 | 9 |
| Ft-M10 | TTTCTACAAATATCTT | 16 | I (−21) | 18 | 8 |
| Ft-M11 | AATTATAAAT | 10 | I (−113) | 5 | 5 |
| Ft-M12 | TAGCTTTTTT | 10 | I (−113) | 2 | 2 |
| Ft-M13 | CTCCAGGACCAA | 12 | G (+1174) | 2 | 2 |
| Ft-M14 | TCATTA | 6 | G (+67) | 3 | 3 |
| Ft-M15 | ATACTT | 6 | G (+32) | 2 | 2 |
| Ft-M16 | TAAAAGTAAG | 10 | I (+551) | 2 | 2 |
| Ft-M17 | TATTTA | 6 | G (+484) | 3 | 3 |
| Ft-M18 | CATTAA | 6 | I (−52) | 4 | 4 |
| Ft-M19 | TAAATTTCTCATA | 13 | I (−20) | 2 | 2 |
| Ft-M20 | ATTATTTTGATC | 12 | G (+1964) | 3 | 3 |
| Ft-M21 | TCAATTA | 7 | G (+586) | 3 | 4 |
| Ft-M22 | AAAAAT | 6 | G (+2254) | 2 | 2 |
| Ft-M23 | AAGTAGCATTGTCACGACCTCCT | 23 | I (+1864) | 2 | 2 |
| Ft-M24 | ATAAATTATTTATTTTGATTA | 21 | I (−93) | 1 | 1 |
| Ft-M25 | GT | 2 | G (+525) | 5 | 5 |
| VNTR-1 | CAAAGACA | 8 | I (−392) | 1 | 3 |
| VNTR-2 | TTTATATAAGT | 11 | I (−42) | 3 | 2 |
| VNTR-3 | GAAAATAA | 8 | G (+282) | 1 | 2 |
| VNTR-4 | TTCTACAAATATCTTT | 16 | I (+22) | 2 | 3 |
| VNTR-5 | AAAATGCCATCATATAGCCAAGATTTTAG | 29 | I (−32) | 1 | 1 |
a
FtM1-FtM25 VNTR markers as previously reported by Johansson et al. [7]. New VTNR polymorphisms identified in this study are listed as VNTR1 through VNTR-5.
b
Indicates repeat size in nucleotides.
c
“G” indicates that the repeat is located within an open reading frame (genic) whereas “I” indicates that the repeat is located within an intergenic region. Distance to predicted translation start site is indicated in nucleotides. “+” or “−” indicates that the translation start site is downstream or upstream of repeat motif, respectively (as reported by Johansson et al. [7]).