Table 2.
Top 20 novel abundantly-expressed miRNAs in S. japonicum
MicroRNA Name | Mature Arm | miR*a | Most abundant sequence | Len | Expressionc (TPMb) | ||
---|---|---|---|---|---|---|---|
AduMix | schistosomulum | P-valued | |||||
Sja-Novel-16 | 5' | Y | UGAUAUGUAUGGGUUACUUGGU | 22 | 16802 | 1405 | 0 |
Sja-Novel-137 | 5' | Y | AGAGGUAGUGAUUCAUAUGACU | 22 | 8800 | 3484 | 0 |
Sja-Novel-110 | 3' | Y | UGAGAUCGCGAUUAAAGCU | 19 | 6477 | 6 | 0 |
Sja-Novel-148 | 5' | Y | UCCCUGAGACUGAUAAUUGCU | 21 | 4888 | 909 | 0 |
Sja-Novel-70 | 5' | Y | UCAGCUGUGUUCAUGUCUUCGA | 22 | 843 | 1 | 0 |
Sja-Novel-168 | 3' | Y | UAUUAUGCAACGUUUCACUCU | 21 | 164 | 439 | 0 |
Sja-Novel-166 | 3' | Y | UGAGAUUCAAUUACUUCAACU | 21 | 345 | 8 | 0 |
Sja-Novel-37 | 3' | Y | UAUUGCACUUACCUUCGCCUUG | 22 | 169 | 57 | 0 |
Sja-Novel-173 | 5' | N | CAGACUCACAGAAAUGCUAA | 20 | 31 | 29 | 0.159 |
Sja-Novel-245 | 5' | Y | UCUUUGGUUAUCAAGCAAUAUGA | 23 | 46 | 10 | 0 |
Sja-Novel-239 | 3' | N | CUGAGAAUCUGUUGGAUGUU | 20 | 23 | 27 | 0.001 |
Sja-Novel-255 | 3' | N | GGCGGAUAGGGAGUUGGCGU | 20 | 35 | 13 | 0 |
Sja-Novel-120 | 3' | N | ACGAGGGCGCUGCAGGGGUUUU | 22 | 24 | 2 | 0 |
Sja-Novel-121 | 3' | N | GCCAAGACGCGUCACGACAUUU | 22 | 20 | 4 | 0 |
Sja-Novel-35 | 5' | N | UGGACACAGUAGCCUAGUGGUU | 22 | 16 | 7 | 0.0008 |
Sja-Novel-36 | 3' | Y | UAUCACAGUCCAAGCUUUGGUAA | 23 | 10 | 13 | 0.0054 |
Sja-Novel-147 | 5' | N | UGGCAAGAUUACGGCGAAGCU | 21 | 18 | 4 | 0 |
Sja-Novel-128 | 5' | N | AAGCGUUCGGACGUUGGCAC | 20 | 19 | 1 | 0 |
Sja-Novel-203 | 5' | N | AGUUAUAUUUAAGUUGGAUUUU | 22 | 8 | 12 | 0.0012 |
Sja-Novel-21 | 5' | Y | AAGUUCUGAUAGAUGUUGCA | 20 | 16 | 4 | 0 |
aY indicates that the sequences from both strands of a miRNA* species were found, while N means that only the sequence from one strand of a miRNA* was identified.
bThe abundance value of each miRNA was normalized to "transcripts per million (TPM)". If the value after normalization was less than 1, the normalized value was set as 1.
cThe expression of miRNA was the sum of the total counts of unique reads which was within ±2 nt variations of the mature miRNA on the precursor.
dThe differentially expressed miRNAs were analyzed using general Chi-square tests.
Len means length of miRNAs. Adumix means miRNA of parasites of mixed adult.