Table 2.
Characteristics of microsatellite loci used to assess individual heterozygosity in southern dunlins (n = 76 individuals)
| Locus* | No. of alleles | Allele size range (bp) | HO | HE |
|---|---|---|---|---|
| Calp2 | 8 | 127-147 | 0.684 | 0.711 |
| Calp4 | 5 | 118-128 | 0.173† | 0.451 |
| Calp5 | 4 | 112-118 | 0.500 | 0.590 |
| Ruff1 | 9 | 175-215 | 0.868 | 0.842 |
| Ruff6 | 7 | 123-147 | 0.763 | 0.779 |
| Ruff9 | 6 | 180-200 | 0.763 | 0.791 |
| Ruff10 | 6 | 252-280 | 0.421† | 0.649 |
| PGT83‡ | 8 | 155-171 | 0.697 | 0.754 |
| 4A11 | 2 | 143-145 | 0.167 | 0.359 |
For each locus, the name, the source species from which the locus was originally isolated and its reference are presented. Amplification results are shown as number of alleles, range of allele sizes in base pairs (bp), observed (HO) and expected heterozygosity (HE).
*Locus name (source species, reference): Calp2-5 (Calidris alpina, [54]); Ruff1-10 (Philomachus pugnax, [55]); PGT83 (Calidris canutus; D.M. Buehler, A.J. Baker, unpublished data; GenBank Accession number AY198173); 4A11 (Haematopus ostralegus, [56]).
†Significant deviation from Hardy-Weinberg Equilibrium (χ2 = 26.7, df = 1, p < 0.001, and χ2 = 9.5, df = 1, p < 0.01, respectively).
‡Primer sequence (5'-3'); F: AATCCGTTTCTGGGGACTGGG, R: TGCCTAATGCTGACTCACACC (A. Pauliny, unpublished data).