Knockdown of β-actin in PMVECs. For knockdown experiments, four lentiviral constructs were generated, which targeted four regions of the rat β-actin mRNA (target sequences: #1= gaagatttggcaccacacttt, #2=caggctgtgttgtccctgtat, #3= gaaatcgtgcgtgacattaaa, and 4= cctgacagactacctcatgaa). PMVECs were infected first with #2641 (selection for blasticidin resistance, 30 ug/ml, 5 days), and then with one of the knockdown constructs (selected for 3 days with with 5 ug/ml of puromycin). Cells were either induced (+) or not (−) with 3 μg/ml of doxycycline (Dox). Western Blotting was performed as described in Materials and Methods, chemiluminescense was documented with Fujifilm LAS-1000 cooled CCD camera, and analyzed with MultiGauge 3.0 program.