Figure 1.

Scheme depicting the different U7 snRNA constructs and the lentiviral vector used in this work. (a) Representation of the different U7 snRNAs and their target on the dystrophin pre-mRNA. Antisense sequences are represented by rectangular boxes. The U7-AS/DS construct targets the acceptor splice (AS) and donor splice (DS) sites of the exon 51 (represented by hatched boxes) and the U7-AON1/2 construct targets two exonic splicing enhancer (ESE) (represented by black and white boxes). The bifunctional U7-AON-A1 construct carries a complementary sequence to the first ESE (AON1) and a tail harboring two canonical binding sites (TATGATAGGGACTTAGGGTG) for the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1).¹⁶ The control construct U7-AON-A1M targets the same sequence on the exon 51 but carries a mutated tail where the binding sites for hnRNPA1 have been mutated to TACGCT (represented by two lines with crosses). (b) Top: Schematic map of the U7 snRNA lentiviral vectors. The two long-terminal repeats (LTRs) enclose the encapsidation signal (ψ), the Rev-responsive element (RRE), the central polypurine tract (cPPT), the woodchuck hepatitis virus responsive element (WPRE), and the U7 snRNA cassette inversely inserted. Middle: The U7 snRNA cassette is constituted of the engineered U7 snRNA sequence (gray box) carrying different antisense sequences with or without tail as previously described (bottom), placed under the control of its natural U7 promoter (hatched box) and 3′ downstream elements (open box). AON, antisense oligonucleotide; snRNA, small nuclear RNA.