Table 1. List of the primers used for full length NSs gene amplification and mutagenesis, s - sense primer, a - antisense primer.

Name	5′ to 3′ sequence	Description
NSs-s	CTAGCTAGCCATATGTCAACTGCAAAGAATGC	Sense primer used to amplify the full length of NSs gene. Under lined sequence corresponds to NheI and NdeI restriction sites.
NSs-a	CCCTCGAGGGTTATTCTGCTTTCACAATGAAGTG	Primer corresponding to 3′ end of NSs gene in the antisense orientation. Under lined sequence corresponds to XhoI restriction site.
NSs K189A-s	CTGTTATGGGAGCGACAACATCCTACTGGAGAG	Sense primer used for mutation of K189 in Walker A motif to A.
NSs K189A-a	CTCTCCAGTAGGATGTTGTCGCTCCCATAACAG	Antisense primer used for mutation of K189 to A
NSs D159A-s	CCCTCCGGATGGTATCAAGCTGAATGCTG	Sense primer used for mutation of D159 in Walker B motif to A. Under lined sequence corresponds to Kpn21 restriction site.
NSs D159A-a	CAGCATTCAGCTTGATACCATCCGGAGGG	Antisense primer used for mutation of D159 to A. Under lined sequence corresponds to Kpn21 restriction site.

All the mutations were confirmed by DNA sequencing.