Table 4. Primers used for the amplification and sequencing of the nine genetic loci evaluated for the B. quintana MLST scheme.
Locus | Putative gene product | Product size (bp) | Position on chromosome (bp) 1 | Forward primer (5′-3′) | Reverse primer (5′-3′) |
atpF | ATP Synthase ß-chain | 606 | 391.779–392.384 | catcagagcatgcagatcgt | cgatgcacaatcatttctgg |
bqtR | B. quintana transcriptional regulator | 622 | 76.463–77.084 | ttgcgacaaaacagcttcac | gatggagcatctgcactcaa |
ftsZ | cell devision protein ftsZ | 531 | 1.036.753–1.037.283 | ccatagcaaaagcatcagca | aattgaagccacgcattacc |
gap | glyceraldehyde 3-phosphate dehydrogenase | 612 | 1.408.521–1.409.132 | caaaaccaatcccacagctt | ttgcgtgctattgtggagag |
gltA | citrat synthase | 558 | 811.826–812.383 | gcggttatcctatcgaccaa | ctgctgcgatacatgcaaat |
groEL | Heat shock protein 60 chaperone | 569 | 1.277.324–1.277.892 | attggaggcattggagtgtc | cgcgtaaaccaaatcaaggt |
nlpD | lipoprotein, outer membrane protein | 548 | 584.964–585.511 | gacgctttctcctgatggtc | tcaataaacgccctcgtacc |
ribE | riboflavin synthase α-chain | 575 | 654.876–655.450 | gttcggaaatgaccgttgtt | gcttgtccccaagttgtcat |
rpoB | RNA polymerase ß-subunit | 605 | 847.962–847.358 | tggtgatcgggtagagaagg | gacgcgcataaacattacga |
Corresponding to the complete genome sequence of B. quintana strain Toulouse/copy Uppsala, GenBank accession number BX897700.1.