Table 1.
Primer namea | Sequence 5′-to-3′ | Size (mer) | 5′ end binding siteb |
---|---|---|---|
Mouse GSP1 mCB2-R301 | CGACCCCGTGGAAGACGTGGAAGATGACAA | 30 | 301bp downstream ATG |
Mouse GSP2 mCB2-R217 | TGAACAGGTACGAGGGCTTTCT | 22 | 217bp downstream ATG |
Human GSP1 hCB2-R298 | GCCAGGAAGTCAGCCCCAGCCAAGCTGCCAA | 31 | 298bp downstream ATG |
Human GSP2 hCB2-R163 | GCACAGCCACGTTCTCCAGGGCACTTAGCA | 30 | 163bp downstream ATG |
GSP, gene specific primer; 1 designates used for the initial RACE PCR, 2 used for nested PCR.
The number of base pairs from the start of translation in which the 5′ end of the GSP binds for amplification of CB2. The primers were designed to include enough of the coding region for CB2 confirmation of the RACE transcripts.