Table 2.
Primer sequences and PCR conditions.
Primer | Oligonucleotide sequence (5'-3') | Nucleotide positions* | Annealing temperature | Amplicon length | Genbank accession no. |
---|---|---|---|---|---|
fimB-550F | GGTAAGTGATGGTATTGATGTC | 550-571 | 45 | 347 | AY321316 |
fimB-875R | GTGTTCCTTCTTCCTCAGTATT | 875-896 | |||
gtf-F | GGTGAGACTTGGGTTGATTC | 2049-2068 | 54 | 496 | AB292595 |
gtf-R | GCTCTGCTTGAACAACTGGA | 2525-2544 | |||
pilB-385F | AAGGGACGAGGGCTCTAC | 120017-120034 | 58 | 339 | CP000408 |
pilB-722R | ACCCAATTCCAACATACG | 120373-120356 |
*positions according to the respective Genbank accession no.