TABLE 1.
Specific primers and probes used in real-time PCR for detection of the avian influenza virus H5 gene, Tobacco mosaic virus, and the influenza virus A matrix gene
| Specificity | Primer or probe | Sequence (5′→3′)a | Locationb | Concn in PCR mixture (nM) | Estimated melting temp (°C)c |
|---|---|---|---|---|---|
| Avian H5 virus gene | H5-F1532 | ACGTATGACTAYCCGCAGTATTCAGAAGA | 1532-1560 | 400 | 67.9-69.3 |
| H5-P1646 | FAM-ATGATTGCCAGTGCTAGRGARCTCGC-BHQ-1 | 1671-1646 | 300 | 69.9-71.5 | |
| H5-R1692 | AACGAYCCATTGGAGCACATCC | 1713-1692 | 400 | 66.2-68.1 | |
| TMV | TMV-F4675 | AGTTGATCTCGAAACTTGGTGCT | 4675-4697 | 100 | 65.0 |
| TMV-P4713 | HEX-TGGGAACACTTGGAGGAGTTCAGAAGGTCT-BHQ-1 | 4713-4742 | 150 | 71.8 | |
| TMV-R4802 | AGCGTCGTCCAACTGTGTGT | 4783-4802 | 100 | 66.6 | |
| Influenza virus A | InA/M-F | AGACCRATCYTGTCACCTCTGAC | 170-192 | 800 | 65.2-67.9 |
| matrix gene | InA/M-P | FAM-TCACCGTGCCCAGTGAGCGAGGACTGC-BHQ-1 | 222-248 | 200 | 76.1 |
| InA/M-R | AGGGCATTYTGRACAAAICGTCTACG | 251-276 | 800 | 67.2-69.2 |
a
IUPAC ambiguity codes are used (R = A or G; Y = C or T). The most frequently encountered mismatches with the targeted sequences are indicated by underlining.
b
Primer and probe annealing positions corresponding to positions in the HA or matrix gene of A/mute swan/Germany/R1349/07 (H5N1) (accession numbers AM749442 and AM913994, respectively) and to positions in the TMV genome (based on accession number AF165190).
c
The melting temperatures were estimated using the OligoAnalyzer 3.1 software (Integrated DNA Technologies).