TABLE 1.
Strains, plasmids, and primers
| Strain, plasmid, or primer | Derivation and/or relevant characteristicsa | Source or reference(s) |
|---|---|---|
| Synechocystis sp. strains | ||
| PCC 6803 | Wild type | J. Zhao |
| wt-1188 | Kmr, Kmr cassette integrated into the neutral platform in slr0168 | 19, 34 |
| DRHB199b | Kmr, sll0861::C.K, generated by transformation with pHB1099 | This study |
| DRHB200 | Kmr, sll0862::C.K, generated by transformation with pHB200 | This study |
| DRHB199 DRHB3054 | Kmr Spr, omega-P6803rbcL-mlla-1 integrated into the neutral platform in the genome of the sll0861::C.K mutant, generated by transformation of DRHB199 with pHB3054 | |
| DRHB199 DRHB3055 | Kmr Emr, sll0860-sll0861-C.CE2 integrated into the neutral platform in the genome of the sll0861::C.K mutant, generated by transformation of DRHB199 with pHB3055 | This study |
| DRHB199 DRHB3157 | Kmr Spr, omega-P6803rbcL-murQ integrated into the neutral platform in the genome of the sll0861::C.K mutant, generated by transformation of DRHB199 with pHB3157 | This study |
| Anabaena sp. strains | ||
| PCC 7120 | Wild type | FACHBc |
| DRHB322-2 | Nmr, alr2432::C.K, generated by homologous double crossover of pHB322-2 with Anabaena chromosome | This study |
| DRHB322-2(pHB2949) | Nmr Spr, pHB2949 carrying omega-P7120rbcL-mlla-1 introduced into the alr2432::C.K mutant | This study |
| DRHB322-2(pHB3158) | Nmr Spr, pHB3158 carrying omega-P7120rbcL-murQ introduced into the alr2432::C.K mutant | This study |
| Microcystis aeruginosa PCC 7806 | Wild type | FACHBc |
| Escherichia coli TJ2 | murQ::Kmr | 14 |
| Plasmidsd | ||
| pET21b | Apr, expression vector | Novagen |
| pHB187 | Apr, PCR fragment bearing sll0861-sll0862 (Synechocystis PCC 6803 chromosomal bp 1161737 to 1165229), generated with primers sll0861-F and sll0861-R, cloned into the EcoRI site of pRL500 | This study |
| pHB199 | Apr, C.K cloned into KpnI-cut and T4 DNA polymerase-blunted pHB187, with sll0861 disrupted | This study |
| pHB200 | Apr, C.K cloned into NheI-cut and T4 DNA polymerase-blunted pHB187, with sll0862 disrupted | This study |
| pHB313 | Apr, PCR fragment bearing alr2432 (Anabaena PCC 7120 chromosomal bp 2923983 to 2925710), generated with primers alr2432-F and alr2432-R, cloned into pMD18-T | This study |
| pHB322-1 | Kmr Apr, C.K inserted into HpaI-cut and T4 DNA polymerase-blunted pHB313, with alr2432 disrupted | This study |
| pHB322-2 | Cmr Kmr, alr2432::C.K fragment excised with SphI and SalI from pHB322-1, cloned into SphI/SalI-cut pRL271 | This study |
| pHB1347 | Kmr Spr, plasmid containing omega-P7120rbcL in pHB912 | 32 |
| pHB2739 | Apr, PCR fragment containing P6803rbcL (Synechocystis PCC 6803 chromosomal bp 2477976 to 2478410), generated with primers 6803rbcL-F and 6803rbcL-R, cloned into pMD18-T | This study |
| pHB2759 | Apr Spr, omega cassette excised with BamHI from pRL57, blunted with T4 DNA polymerase, cloned into SalI-cut and T4 DNA polymerase-blunted pHB2739 | This study |
| pHB2909a | Apr, PCR fragment containing mlla-1 (Microcystis PCC 7806 chromosomal bp 65241 to 66280), generated with primers 7806-F and 7806-R, cloned into pMD18-T, oriented against PlacZ | This study |
| pHB2909b | Apr, PCR fragment containing mlla-1 (Microcystis PCC 7806 chromosomal bp 65241 to 66280), generated with primers 7806-F and 7806-R, cloned into pMD18-T, oriented against like PlacZ | This study |
| pHB2912 | Apr Spr, omega-P6803rbcL excised with PstI/XbaI from pHB2759, blunted with T4 DNA polymerase, inserted into SalI-cut and T4 DNA polymerase-blunted pHB2909a, oriented like mlla-1 | This study |
| pHB2913 | Apr Spr, omega-P7120rbcL excised with NheI from pHB1347, blunted with T4 DNA polymerase, inserted into SalI-cut and T4 DNA polymerase-blunted pHB2909a, oriented like mlla-1 | This study |
| pHB2949 | Apr Spr Kmr, omega-P7120rbcL-mlla-1 excised with PvuII from pHB2913, inserted into EcoRI-cut and T4 DNA polymerase-blunted pRL25C | This study |
| pHB2982 | Apr, PCR fragment containing sll0861 (Synechocystis PCC 6803 chromosomal bp 1163322 to 1164363), generated with primers 6803sll0861-F and 6803sll0861-R, cloned into pMD18-T, oriented like PlacZ | This study |
| pHB3012 | Apr, PCR fragment bearing sll0860-sll0861 (Synechocystis PCC 6803 chromosomal bp 1163322 to 1165090), generated with primers 6803sll0860-F and 6803sll0861-R, cloned into pMD18-T | This study |
| pHB3032 | Apr Cmr, C.CE2 excised with SalI from pRL598, blunted with T4 DNA polymerase, inserted into BamHI-cut and T4 DNA polymerase-blunted pHB3012 | This study |
| pHB3054 | Apr Spr, omega-P6803rbcL-mlla-1 excised with PvuII from pHB2912, cloned into EcoRI-cut and T4 DNA polymerase-blunted pKW1188, replacing the Kmr fragment | This study |
| pHB3055 | Apr Cmr, sll0860-sll0861-C.CE2 excised with SacI/PstI from pHB3032, cloned into EcoRI-cut and T4 DNA polymerase-blunted pKW1188, replacing the Kmr fragment | This study |
| pHB3146 | Apr, PCR fragment bearing E. coli murQ, generated by PCR with primers murQ-F and murQ-R, cloned into pMD18-T | This study |
| pHB3147 | Apr Spr, omega-P6803rbcL excised with PstI/XbaI from pHB2759, blunted with T4 DNA polymerase, inserted into SalI-cut and T4 DNA polymerase-blunted pHB3146, oriented like murQ | This study |
| pHB3148 | Apr Spr, omega-P7120rbcL excised with NheI from pHB1347, blunted with T4 DNA polymerase, inserted into SalI-cut and T4 DNA polymerase-blunted pHB3146, oriented like murQ | This study |
| pHB3157 | Apr Spr, omega-P6803rbcL-murQ excised with PvuII from pHB3147, cloned into EcoRI-cut and T4 DNA polymerase-blunted pKW1188, replacing the Kmr fragment | This study |
| pHB3158 | Apr Spr Kmr, omega-P7120rbcL-murQ excised with PvuII from pHB3148, inserted into EcoRI-cut and T4 DNA polymerase-blunted pRL25C | This study |
| pHB3908 | Apr, fragment bearing an E. coli ribosome-binding site and partial sll0861 sequence was excised from pHB1330 with BglII/BalI and used to replace the BalI/BamHI fragment in pHB2982, resulting in a clone with sll0861 expressed based on PlacZ and E. coli ribosome-binding site (designated sll0861′) | This study |
| pKW1188 | Apr Kmr, plasmid bearing a neutral integrative platform for Synechocystis PCC 6803 | 34 |
| pMD18-T | Apr, T-cloning vector | Takara, Dalian, People's Republic of China |
| pRL25C | Kmr, pDU1-based E. coli-Anabaena shuttle vector | 36 |
| pRL57 | Spr, cloning vector with the spectinomycin resistance cassette omega | 4 |
| pRL271 | Cmr, sacB-bearing positive selection vector | 4 |
| pRL446 | Kmr, cloning vector with the C.K cassette | 9; GenBank accession no EU346690.1 |
| pRL500 | Apr, positive-selection vector | 9 |
| pRL598 | Cmr Emr, cloning vector with the C.CE2 cassette | 9 |
| Primers (5′-3′) | ||
| 6803rbcL-F | CCGATGAAGTGGTGGAGCA | |
| 6803rbcL-R | GGTCAGTCCTCCATAAACATTG | |
| 6803sll0860-F | CTAGTTCATTTCTCCACCGG | |
| 6803sll0861-F | CCCGATCATCTTTCTCCCATCC | |
| 6803sll0861-R | TGGCGAAGACAATGGGGACT | |
| 7806-F | TCTTACGAAAAGCTCAATTAAACCG | |
| 7806-R | AAGATAGCACCAGCGACGAGG | |
| alr2432-F | TCCCAAGATGATGCTGTCCGT | |
| alr2432-R | CCGACAACCGTAGGAGGTAA | |
| murQ-F | CGTAAATAGTAAGGTCACCACCG | |
| murQ-R | CGACACGGGTAAGAATGGTG | |
| sll0861-F | TTGAATTCCACTGTCCAACGACCATAGAC | |
| sll0861-R | ACGAATTCAAGATACGGAAGTAGTGCTG |
a
Ap, ampicillin; Cm, chloramphenicol; Em, erythromycin; Km, kanamycin; Nm, neomycin; Sp, spectinomycin.
b
DRHB indicates a product of double homologous recombination between a pHB plasmid and the Synechocystis sp. or Anabaena sp. genome.
c
FACHB, Freshwater Algal Culture Collection of the Institute of Hydrobiology.
d
The templates used for PCRs were genomic DNA of Anabaena PCC 7120, E. coli DH5α, and Synechocystis PCC 6803; PCR clones were confirmed by sequencing.