Table 2.
Quantitative analysis results of mRNA expression of 10 differentially expressed proteins in PBMCs from HIV-positive patients and healthy donors.
| gene name | strand | primer | Aaymp. Sig.(2-tailed) | Number (HIV/Normal) |
Mean peak (HIV/Normal) |
Expression of proteins in HIV |
|---|---|---|---|---|---|---|
| KPYM | sense | ctatcctctggaggctgtgc | 0.029 | 10/10 | 0.6 | ↑11.9 |
| antisense | ccagacttggtgaggacgat | |||||
| TLN1 | sense | tctcccaaaatgccaagaac | 0.022 | 20/22 | 1.5 | ↑4.1 |
| antisense | ctccactagcccttgctgtc | |||||
| CAP1 | sense | gtgtcaacagccagcagaaa | 0.004 | 10/10 | 0.8 | Only |
| antisense | gcggcatcattcatttcttt | |||||
| ENOA | sense | gagctccgggacaatgataa | 0.631 | 10/10 | 1.1 | Only |
| antisense | tgttccatccatctcgatca | |||||
| EHD3 | sense | ctaaccctgtgctggagagc | 0.009 | 10/10 | 0.8 | Only |
| antisense | gtcagctttgttcagcacca | |||||
| COR1C | sense | gcagaagagtggttcgaagg | 0.047 | 20/22 | 1.4 | ↑2.0 |
| antisense | tgatcaggtcgcacttcttg | |||||
| ST1A3 | sense | catgaaggagaaccccaaaa | 0.739 | 10/10 | 1.1 | ↑1.8 |
| antisense | tgaaggtggtcttccagtcc | |||||
| FLNA | sense | aagtgaccgccaataacgac | 0.393 | 10/10 | 0.8 | ↑1.7 |
| antisense | ggcgtcaccctgtgacttat | |||||
| VINC | sense | gccaagcagtgcacagataa | 0.007 | 20/22 | 1.6 | ↑14.1 |
| antisense | tctttctaacccagcgcagt | |||||
| GNB1 | sense | cttgtgatgcttcagccaaa | 0.078 | 20/22 | 1.4 | ↓1.5 |
| antisense | tcagcacgaaggtcaaacag |
Isolated PBMCs from HIV-positive and healthy donors were treated with Trizol regent and RNA was extracted according to the manufacturer's instructions. The primers were obtained through primer 3.0 software analysis. The data were statistic analyzed through Mann-Whitney test.