Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
External and internal primer sets for the amplification of a partial region of the 18S gene of most filarial species.
| Primer name | Sequence (5'-3') |
|---|---|
| PAFilariaF1 (external) | GGTGAAACCGCGAACGGCTC |
| PAFilariaR1 (external) | CCGTCCCTCTTAACCATTATC |
| PAFilariaF2 (internal) | CTATAATGTACTTGATGTTGATTATC |
| PAFilariaR2 (internal) | CCATGCACGAGTATTCAGGCA |
