Table 1. Primers for specific amplification of Seg-2 of BTV-6, by RT-PCR.
Primer pairs | Individual forward and reverse primers* | Primer Sequence (5′ to 3′) | Position on genome segment 2 (nt) | Predicted Product Size (bp) |
Primer pair I | BTV-6/2/301F | GGTGGTATGTATAGAGGAAG | 875-894 | 1631** |
BTV-6/2/790R | ACCACGCTACTCTGTATGCC | 2506–2487 | ||
Primer pair II | BTV-6/2/153F | CGAGGCGATTGGTGACACAGGT | 461-482 | 2226 |
BTV-6/2/853R | CAAAGGGAACCTCGCGCGTAATC | 2687–2664 | ||
Primer pair III | BTV-6/2/35F | GAGCGAAGATGATGAGGT | 107–124 | 1211 |
BTV-6/2/439R | GTCTTCTTCGTCTGTGAGATCAA | 1318–1295 |
*Individual primers are identified by the BTV serotype (e.g. BTV-6) followed by the number 2 (to indicate Seg-2), then a number to indicate the relative amino acid position of the primer within VP2, followed by F or R to indicate forward or reverse orientation.
**This primer pair also amplifies Seg-2 of BTV-14 and BTV-21, the most closely related serotypes to BTV-6 within nucleotype ‘C’ and it is therefore regarded as nucleotype ‘C’ specific.