Skip to main content
. 2010 Mar 12;38(8):2570–2576. doi: 10.1093/nar/gkq099

Figure 1.

Figure 1.

A traditional method of genetic engineering the MG259 locus of a synthetic M. genitalium genome maintained in yeast. (A) The scheme of repairing a point mutation through two homologous recombination procedures. First, a region of 146 bp with point mutation (asterisk) in the MG259 locus of M. genitalium genome (M. gen genome) is replaced with the URA3 marker via 50-bp homologous sequences. Second, a 328-bp DNA fragment replaces the URA3 marker. The loss of the URA3 marker is selected for by 5-FOA. Two PCR diagnosis primers (red arrows), Seq-F (gttagtttaccaatccagtc) and Seq-R (aatgcttggatatcaatatc), are separated by 0.4 kb in MG259 locus, and the insertion of the 1.1-kb URA3 marker results in the generation of a 1.3-kb PCR product when using these primers. (B) PCR analysis of 22 5-FOA resistant clones after the second round of homologous recombination using primers Seq-F and Seq-R. C1, DNA purified from the yeast strain containing an M. genitalium genome with the URA3 marker insertion in MG259 locus and C2, DNA purified from the yeast strain containing an M. genitalium genome before the insertion of URA3 marker in MG259 locus. (C) Analysis of M. genitalium genome completeness by multiplex PCR. Ten pairs of primers should produce 10 amplicons (ranging from 0.125 to 1.25 kb in 0.1-kb increments) distributed around the M. genitalium genome approximately every 60 kb as shown in control C1 DNA and C2 DNA. M, 100-bp DNA ladder and 1–22: DNA analyzed from 22 5-FOA resistant colonies. (D) Possibilities for URA3 marker loss from an M. genitalium cloned in yeast. A 583 kb of the M. genitalium genome was cloned as yeast artificial chromosome (YAC), carrying a histidine marker (HIS3) and a centromere (CEN6), and the URA3 marker was inserted into the MG259 locus. 5-FOA resistant strains (5-FOA+) could be derived either from the replacement of the URA3 marker with the wild type DNA fragment (R1) or from recombination between two repetitive sequences (blue arrow) (R2). Size and locations of repeat sequences are schematic.