Skip to main content
. 2010 Mar 12;38(8):2570–2576. doi: 10.1093/nar/gkq099

Figure 2.

Figure 2.

Seamless deletion using the TREC method. (A) The outline of the TREC method. Through homologous recombination, a 450-bp region located at the MG259 locus is replaced with a mutagenesis cassette that consists of a knock-out CORE (an18-bp I-SceI recognition site, the SCEI gene under the control of a GAL1 promoter, and the URA3 marker) and a DNA fragment (shown in white arrow) identical to a region upstream of the target site. The replacement generates tandem repeat sequences flanking the CORE. Galactose induces the expression of I-SceI, which generates a double-strand break (DSB) at the I-SceI site near the target locus. The DSB promotes an intra-molecular homologous recombination (dash line) between the repeat sequences, leading to an excision of the CORE. (B) Replica-plating steps used for selection of M. genitalium genome modification. URA3 positive transformants were grown on SD-HIS-URA medium, followed by replica plating to either galactose or glucose plates. After a 2-day incubation, cells were replica-plated onto SD-HIS containing 5-FOA. 5-FOA-resistant cells were re-streaked out to produce single colonies for PCR analyses. (C) PCR analysis using the diagnosis primers, Seq-F and M2-det1(aagtaactagcaatttgttg), for excision of the mutagenesis cassette. DNA was prepared from 24 colonies replica-plated from either galactose or glucose plate, respectively. DNA with a precise deletion would give rise to a 0.55-kb PCR product, compared to a 1-kb PCR product from un-modified DNA. (D) Analysis of the integrity of the M. genitalium genome. Ten DNA samples from galactose-induced and -uninduced 5-FOA resistant clones in (C) were further analyzed by multiplex PCR using the same primer sets described in Figure 1C. M, 100-bp DNA ladder. C, DNA purified from Ura+ transformants before galactose induction and 5-FOA selection.