TABLE 2.
In silico search of immunostimulatory motifs on sense and antisense strands of Bifidobacterium genomesa
| CpG motif | Sequence | B. longum NCC2705 | B. longum DJO10A | B. longum subsp. infantis ATCC 15697 | B. adolescentis ATCC 15703 | B. animalis subsp. lactis AD011 |
|---|---|---|---|---|---|---|
| Type 1b | AACGTT | 296 | 313 | 375 | 433 | 151 |
| AACGTC | 541 | 611 | 698 | 703 | 386 | |
| AACGCT | 424 | 414 | 560 | 589 | 285 | |
| AACGCC | 1,203 | 1,253 | 1,546 | 1,191 | 894 | |
| AGCGTT | 485 | 492 | 501 | 476 | 320 | |
| AGCGTC | 629 | 661 | 817 | 705 | 572 | |
| AGCGCT | 469 | 486 | 485 | 370 | 361 | |
| AGCGCC | 995 | 1,054 | 1,174 | 928 | 838 | |
| GACGTTc | 528 | 571 | 729 | 730 | 385 | |
| GACGTC | 648 | 668 | 865 | 844 | 778 | |
| GACGCT | 527 | 660 | 859 | 744 | 541 | |
| GACGCC | 1,516 | 1,651 | 2,097 | 1,371 | 1,294 | |
| GGCGTT | 1,186 | 1,300 | 1,540 | 1,144 | 894 | |
| GGCGTC | 1,538 | 1,661 | 2,046 | 1,460 | 1,353 | |
| GGCGCT | 975 | 1,070 | 1,179 | 933 | 921 | |
| GGCGCC | 1,014 | 1,054 | 1,490 | 1,112 | 1,433 | |
| Type 1 total | 12,974 | 13,919 | 16,961 | 13,733 | 11,406 | |
| Type 2 | ATCGTT | 553 (596) | 564 (640) | 666 (718) | 573 (593) | 405 (341) |
| ATCGTC | 1,250 (1,236) | 1,312 (1,312) | 1,591 (1,600) | 1,408 (1,406) | 1,204 (1,152) | |
| ATCGCT | 501 (435) | 516 (455) | 545 (508) | 425 (434) | 350 (295) | |
| ATCGCC | 2,079 (2,044) | 2,171 (2,196) | 2,460 (2,513) | 1,951 (1,863) | 1,642 (1,715) | |
| GTCGTTd | 663 (632) | 693 (692) | 898 (834) | 661 (681) | 672 (594) | |
| GTCGTC | 960 (931) | 1,076 (999) | 1,275 (1,286) | 1,011 (988) | 1,100 (1,138) | |
| GTCGCT | 526 (508) | 576 (514) | 570 (628) | 537 (550) | 536 (507) | |
| GTCGCC | 1,562 (1,496) | 1,638 (1,597) | 1,949 (1,964) | 1,338 (1,290) | 1,384 (181) | |
| Type 2 total | 8,094 (7,878) | 8,546 (8,405) | 9,954 (10,051) | 7,904 (7,805) | 7,293 (7,123) | |
| Total | 21,068 | 22,465 | 26,915 | 21,637 | 18,699 | |
| Published motifse | ||||||
| BL07 | GCGTCGGTTTCGGTGCTCAC | 1 (0) | 1 (0) | 1 (0) | 0 (0) | 0 (0) |
| OL-LB7 | CGGCACGCTCACGATTCTTG | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| ID35 | ACTTTCGTTTTCTGCGTCAA | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| Active motif of ID35 | TTTCGTTT | 16 (22) | 20 (21) | 26 (28) | 42 (46) | 13 (13) |
| AT ODN | ATTTTTAC | 6 (4) | 8 (3) | 8 (13) | 11 (9) | 2 (1) |
a
Values indicate the number of the times that each sequence appears in the respective genome. The values in parentheses indicate the results for the antisense strand.
b
Palindromic sequences, found equally on antisense strand.
c
Sequence for optimal immunostimulatory motif of murine cells.
d
Sequence for optimal immunostimulatory motif of human cells.