. 2010 Apr 1;1:10. doi: 10.1186/1758-907X-1-10

Table 1.

Examples showing alignment of mature sequences from miR-15 family members and non-family member with matching seeds

Family member	miRNA name	Mature sequence from 5' to 3' end
Family members with sequence identity in both the seed region^aand the 3' region^b	hsa-miR-15a^c	`UAGCAGCACAUAAUGGUUUGUG`
		\| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \|
	hsa-miR-15b^c	`UAGCAGCACAUCAUGGUUUACA`
Family members with sequence identity in the seed region^abut very limited identity in the 3' region^b	hsa-miR-15a^c	`UAGCAGCACAUAAUGGUUUGUG`
		\| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \|
	hsa-miR-16^c	`UAGCAGCACGUAAAUAUUGGCG`
Non-family members with sequence identity both in the seed region^aand in the 3' region^b	hsa-miR-15a^c	`UAGCAGCACAUAAUGGUUUGUG`
		\| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \| \|
	hsa-miR-497^d	`CAGCAGCACACUGUGGUUUGU`

^aBold and italicised.

^bBold.

^cMember of the miR-15 family.

^dMember of the miR-497 family.