| target gene | primer pair | target sequence |
|---|---|---|
| rSRC1 | 5′ | cagcgggagctgtacagtca |
| 3′ | ctgggagtccggatgaagga | |
| rSRC2 | 5′ | gcagcgaactttgatgatga |
| 3′ | cgtagttcggaggaaatgga | |
| rSRC3 | 5′ | gagcaaactcttccgcaatc |
| 3′ | caggattcgggtttggtcta | |
| rCBP | 5′ | gtacagccaccaaggagcat |
| 3′ | ctgccattagctgtgggttt | |
| rp300 | 5′ | ccagacttgggacctttctg |
| 3′ | cctggtttcacctccacagt |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.