TABLE 1.
Bacterial strains and plasmids used in this study
| Strain or plasmid | Relevant genotype or description | Reference or source |
|---|---|---|
| Bacterial strains | ||
| E. coli | ||
| DH5α | recA1 endA1 hsdR17 | 34 |
| CF1648 | Wild-type MG1655 | 46 |
| CF1693 | CF1648 ΔrelA251::kan ΔspoT207::cat | 46 |
| S. pyogenes | ||
| HSC5 | Wild type | 15 |
| HSC5Spc | Wild-type control strain for pSPC18 insertion; pSPC18 was inserted downstream of recF in the chromosome of strain HSC5 without disrupting any gene or operon | 9 |
| ΩCvfA strain | HSC5 mutant with cvfA disruption created by pSPC18::′cvfA′a | This study |
| ΩCvfA::pCIV2::cvfA strain | ΩCvfA strain with pCIV2::cvfA insertion in the chromosome; the disrupted cvfA gene in the ΩCvfA strain was restored by inserting an intact copy of cvfAa | This study |
| ΩCvfA(pRopB-HA) strain | ΩCvfA strain transformed with pRopB-HA | This study |
| Plasmids | ||
| pSPC18 | pUC18-based streptococcal integration vector containing aad9 (spectinomycin resistance gene from Enterococcus faecalis) | 26 |
| pCIV2 | pUC18-based streptococcal integration vector containing aphA3 (kanamycin resistance gene) | 32 |
| pSPC18::′cvfA′ | pSPC18 containing a 0.78-kbp internal fragment of cvfA generated by PCR with the CvfA-f primer (TCCCCGGGAATCTAAACACATTGATGAGCGGC) and the CvfA-r primer (CGCGGATCCTAATTCTCCATTGACTCATTACG)b | This study |
| pCIV2::cvfA | pCIV2 containing an intact copy of cvfA (1.80 kbp) generated by PCR with the CvfAcomp-f primer (ACATGCATGCGAAGCCTACATCATGGACGAC) and the CvfAcomp-r primer (GGGGTACCCTACTTGGCATAATCAACCG)b | This study |
| pRopB-HA | pABG5 derivative containing HA-tagged ropB | 24 |
| pSPC18::′cvfA-6xHis | pSPC18 containing a DNA sequence of the C-terminal part of CvfA fused to the 6× His tag sequence (0.75 kbp) generated by PCR with the CvfA6xΗisBam-f primer (TTTGGATCCTCTCTGATTGCTGATGGTCG) and the CvfA6xHisBam-r primer (TTTGGATCCTCAATGATGATGATGATGATGCTTGGCATAATCAACCGCTCTC)b | This study |
| pCIV2::′eno-HA | pCIV2 containing a DNA sequence of the C-terminal part of enolase (SPy_0731) fused to the HA tag sequence (0.75 kbp) generated by PCR with the EnoSal-f primer (AAAGTCGACAGGTGACGAAGGTGGATTTG) and the EnoHASal-r primer (AAAGTCGACCTAAGCGTAATCTGGAACATCGTAGCTGGTTTTTTTTAAGTTATAGAATGATTTGATAC)b | This study |
a
See Fig. 1.
b
Restriction sites embedded into primer sequences are underlined.