Table 2.
Primers and probes used for TaqMan PCR assays deduced from the lppQ gene sequence of M. mycoides subsp. mycoides SC type strain PG1.
| Primer | Sequence (5′–3′) | Positiona |
|---|---|---|
| lppQ-based TaqMan FT PCR (Bischof et al., 2006) | ||
| lppQTM-L | AATAATCAACAAAAAAAAGAGCAAGTAAGTAA | 1166019–1166050; 1189776–1189807 |
| lppQTM-R | TAGCCCTTTTATTTTTAGTAATGCTTGTAA | 1166144–1166115; 1189901–1189872 |
| lppQTM_FT | ACATCTTGTTTTTGTCACTCATTTTTTGGTTCAATTTT | 1166113–1166076; 1189870–1189833 |
| lppQ-based TaqMan MGB PCR (Vilei et al., 2007) | ||
| lppQTM2-L | CTAGAACTGAGGTTTTAGTAATTGGTTATGA | 1166317–1166347; 1190074–1190104 |
| lppQTM2-R | CACGCTCTAGACTAATAATTTCTTCTGGTA | 1166433–1166404; 1190190–1190161 |
| lppQTM2-MGB | AAAAATTTCTGGGTTTGCTCAA | 1166357–1166378; 1190114–1190135 |
a
Based on nucleotide sequence NC_005364, the complete genome of M. mycoides subsp. mycoides SC type strain PG1 (Westberg et al., 2004). The two copies of lppQ in PG1 span nt 1165902–1167239 and nt 1189659–1190996. Note that lppQ occurs only in one copy in all other M. mycoides subsp. mycoides SC strains (Bischof et al., 2006).