Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for real-time RT-PCR
| Gene (accession number) | Forward | Reverse |
|---|---|---|
| IL6 (NM_031168) | 5'-tagtccttcctaccccaatttcc-3' | 5'-ttggtccttagccactccttc-3' |
| CXCL10/IP10 (NM_021274) | 5'attctttaagggctggtctga 3' | 5'cacctccacatagcttacagt 3' |
| β Actin (NM_007393) | 5'-aaccgtgaaaagatgacccagat-3' | 5'-cacagcctggatggctacgt-3' |
IL6, Interleukin6; CXCL10/IP10, C-X-C motif ligand 10/10 kDa interferon-gamma-induced protein
