FIGURE 6.

Translocation of the artificial RNA sequence UUUUAGCCUCUUUGAGGUCGCCAUGCGAUUUUUUUU through a pore with a length of 5 nt. The RNA enters the pore with its 3′ end. As more and more of the minimum free energy (MFE) structure (black) is occluded by the pore, the RNA refolds into alternative structures (dotted and dashed). At the mid point, the most likely structure is the open chain (solid gray). Note how the probability of the MFE almost reaches 100% at t ≈ 290 when the structure is fully formed but alternative structures are inhibited by the pore.