TABLE 1.
FISH oligonucleotides used in this study
| Probe | Sequence (5′-3′) | Target organism | Helper(s) and/or competitor(s) | Reference |
|---|---|---|---|---|
| EUB338Ia | GCTGCCTCCCGTAGGAGT | Eubacteria | 1 | |
| EUB338IIa | GCAGCCACCCGTAGGTGT | Eubacteria | 7 | |
| EUB338IIIa | GCTGCCACCCGTAGGTGT | Eubacteria | 7 | |
| PAO651a | CCCTCTGCCAAACTCCAG | “Ca. Accumulibacter” | 5 | |
| PAO462a | CCGTCATCTACWCAGGGTATTAAC | “Ca. Accumulibacter” | 5 | |
| PAO846a | GTTAGCTACGGCACTAAAAGG | “Ca. Accumulibacter” | 5 | |
| Acc444 | CCCAAGCAATTTCTTCCC | Acc-SG1 | HAcc462 and HAcc426 | This study |
| HAcc466b | CATCTACTCAGGGTATTAA | Acc-SG1 | This study | |
| HAcc426b | CGCCGAAAGAGCTTTACA | Acc-SG1 | This study | |
| Acc184 | GCTCCCAGAACGCAAGGT | Acc-SG2 | CAcc184 | This study |
| CAcc184c | GCTCCCAGAGCGCAAGGT | Acc-SG2 | This study | |
| Acc72 | GAGTGTTACCACCCCGTG | Acc-SG3 | This study | |
| Acc119 | GGATACGTTCCGATGCTT | Acc-SG4 | HAcc99, HAcc139, and CAcc119 | This study |
| HAcc99b | CTCACCCGTCCGCCACTC | Acc-SG4 | This study | |
| HAcc139b | GCTACGTTATCCCCCACTC | Acc-SG4 | This study | |
| CAcc119c | GGGCACGTTCCGATGCAT | Acc-SG4 | This study |
a
Used as EUBmix and PAOmix, respectively.
b
Helper probes are designated with an H.
c
Competitor probes are designated with a C.