TABLE 3.
Primers
| Primer | Sequence (restriction enzyme)a | Function |
|---|---|---|
| FMH1011 | 5′-GACTCGAGATGAATCGAGTGGAACCGCCC-3′ (XhoI) | Forward primer for the amplification of scoC gene |
| FMH1012 | 5′-GCGGATCCCATCATGAAGCATTTTGATTA-3′ (BamHI) | Reverse primer for the amplification of scoC gene |
| FMH880 | 5′-GAATTC−326GTAGGCGGCAACGG−313-3′ (EcoRI) | Forward primer for the amplification of the 5′ phoPR promoter region |
| FMH881 | 5′-−100CGACAATTCGCCTTTTACA−118-3′ | Reverse primer for the amplification of the 5′ promoter region |
| FMH1018 | 5′-GCGGCCGC−120GATGTAAAAGGCGAATTGTCGG−99-3′ (NotI) | Forward primer for the amplification of the 3′ phoPR promoter region |
| FMH1019 | 5′-CATATG+24CACAACTAAAATTTTCTTGTTC+3-3′ (NdeI) | Reverse primer for the amplification of the 3′ phoPR promoter region |
| FMH1025 | 5′-ATATAAAAGCATTAGTGTATCAATTCAAGC-3′ | Primer within lacZ fusions used for primer extension analysis |
a
Superscript base pair numbering is relative to the A of the ATG translation start site of phoP. Restriction sites are underlined.