Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR and Sequencing Primers for LTS1.
| Primer | Sequence (5′ to 3′) | Position in DNAa | Position in RNAa |
| 350upF | ACAGCCTTTGCCTGTACTCC | –347 to –328 | |
| F1-1R | GAAGGTGGAGATGCTCTTGG | –135 to –154 | |
| F1-1F | CCAAGAGCATCTCCACCTTC | –154 to –135 | |
| 300R | CTGCGTGCCCAGGTAGAAAG | 321 to 302 | 321 to 302 |
| 300F | CTTTCTACCTGGGCACGCAG | 302 to 321 | 302 to 321 |
| R2 | TGTCAGAAGGCCACCAAAAC | 2422 to 2403 | 1309 to 1290 |
+1 is A of starting ATG.
