Skip to main content
letter
. 2010 Jun 10;65(8):1833–1834. doi: 10.1093/jac/dkq207

Table 1.

Primers pairs used by the KPC Resistance Assay Kit to obtain the specific blaKPC amplicons analysed by ESI-MSa

Primer pair nameb 4674 4675 4676
 forward (5–3) TTGCTGGACACACCCATCCGTTAC TACACCCGGACGCCTAACAAGGA TGGAGCTGAACTCCGCCATCC
 reverse (5–3) TCTCCGCCACCGTCATGCCTG TGCCCGTTGACGCCCAATCC TCCAGTGCAGAGCCCAGTGTCAG
Expected base composition after ESI-MS analysisc
blaKPC-2 and all other blaKPC subtypes not listed below A26 G26 C26 T19 A22 G31 C30 T12 A23 G28 C33 T16
blaKPC-3 A26 G26 C26 T19 A22 G31 C29 T13 A23 G28 C33 T16
blaKPC-4 and blaKPC-5 A26 G27 C25 T19 A22 G31 C30 T12 A23 G28 C33 T16

aSpecies identification of Enterobacteriaceae was obtained with the same kit using primers specific for the valS housekeeping gene: 358-forward, 5′-TCGTGGCGGCGTGGTTATCGA-3′; and 358-reverse, 5′-TCGGTACGAACTGGATGTCGCCGTT-3′.

bAll primer sequences for KPC detection are based on GeneBank ID EU784136.

cResults in bold indicate amplicons with different base compositions that identify different KPC variants.