Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Aug 1.
Published in final edited form as: Mol Immunol. 2010 Jun 16;47(14):2314–2322. doi: 10.1016/j.molimm.2010.05.287

The C-terminal region of human NFATc2 binds cJun to synergistically activate interleukin-2 transcription

Tuan N Nguyen 1,1, Loree J Kim 1,2, Ryan D Walters 1, Linda F Drullinger 1, Tricia N Lively 1,3, Jennifer F Kugel 1,*, James A Goodrich 1,*
PMCID: PMC2918688  NIHMSID: NIHMS210048  PMID: 20557936

Abstract

At eukaryotic promoters, multi-faceted protein-protein and protein-DNA interactions can result in synergistic transcriptional activation. NFAT and AP-1 proteins induce interleukin-2 (IL-2) transcription in stimulated T cells, but the contributions of individual members of these activator families to synergistically activating IL-2 transcription is not known. To investigate the combinatorial regulation of IL-2 transcription we tested the ability of different combinations of NFATc2, NFATc1, cJun, and cFos to synergistically activate transcription from the IL-2 promoter. We found that NFATc2 and cJun are exclusive in their ability to synergistically activate human IL-2 transcription. Protein-protein interaction assays revealed that in the absence of DNA, NFATc2, but not NFATc1, bound directly to cJun/cJun dimers, but not to cFos/cJun heterodimers. A region of NFATc2 C-terminal of the DNA binding domain was necessary and sufficient for interaction with cJun in the absence of DNA, and this same region of NFATc2 was required for the synergistic activation of IL-2 transcription in T cells. Moreover, expression of this C-terminal region of NFATc2 specifically repressed the synergistic activation of IL-2 transcription. These studies show that a previously unidentified interaction between human NFATc2 and cJun is necessary for synergistic activation of IL-2 transcription in T cells.

1. Introduction

During an immune response, the presentation of foreign antigen to naive T cells initiates a developmental process that culminates in fully differentiated T cells (Abbas and Lichtman, 2005). This is triggered in part by secretion of critical cytokines such as IL-2, which acts as an autocrine growth factor during the immune response to bacterial and viral infection, as well as tumorigenesis (Abbas and Lichtman, 2005; Avni and Rao, 2000; Rao and Avni, 2000). The activation of T cells initiates a program of gene expression that is primarily controlled at the level of transcription (Abbas and Lichtman, 2005). Two events are necessary to implement this program: 1) the antigen signals through the T cell receptor and 2) a co-stimulatory signal acts through a different receptor, such as CD28 (Macian, 2005). The signal through the T cell receptor stimulates calcium-dependent signaling pathways, including activation of the phosphatase calcineurin, which ultimately allows members of the NFAT (nuclear factor of activated T cells) family of transcriptional activators to localize in the nucleus (Hogan et al., 2003). The co-stimulatory signal results in activation of kinase pathways (e.g. the protein kinase C and RAS-MAPK pathways). Cultured T cells can be co-stimulated with the calcium ionophore ionomycin and phorbol myristate acetate (PMA) (Flanagan and Crabtree, 1992).

The activation of many genes upon T cell co-stimulation, including IL-2, involves the NFAT and AP-1 (activator protein 1) families of transcriptional activators, which bind DNA cooperatively. NFATc2 (also known as NFAT1 and NFATp) and NFATc1 (also known as NFAT2 and NFATc) are the predominant NFAT proteins expressed in T cells (Lyakh et al., 1997). NFATc2 is present in the cytoplasm of T cells prior to stimulation and rapidly enters the nucleus after T cells are stimulated (Loh et al., 1996; Timmerman et al., 1996). NFATc1 is not detected in unstimulated T cells, but is synthesized and enters the nucleus a few hours after T cells are stimulated (Lyakh et al., 1997; Timmerman et al., 1997). The AP-1 family consists of homodimers and heterodimers formed between the Jun and Fos proteins (Chinenov and Kerppola, 2001; Ransone et al., 1989; Turner and Tjian, 1989). The AP-1 proteins cJun and cFos are present in the nuclei of T cells before stimulation and both cJun/cJun homodimers and cFos/cJun heterodimers bind DNA cooperatively with NFATc2 and NFATc1 (Chen et al., 1995; Hoey et al., 1995; Jain et al., 1992; McGuire and Iacobelli, 1997; Peterson et al., 1996).

The multi-faceted protein-protein and protein-DNA interactions that occur at a promoter can result in transcriptional synergy. Synergy occurs when the level of transcription caused by two or more factors together is greater than the sum of the levels caused by the factors individually (Carey et al., 1990; Han et al., 1989; Lin et al., 1988; Lin et al., 1990). The cooperative binding of activators to promoter DNA elements to form a stable nucleoprotein complex can be considered the first layer of transcriptional synergy (Carey, 1998). A minimal IL-2 promoter spanning from −300 to +40 fully responds to stimulation in T cells, and contains four composite elements to which NFAT and AP-1 proteins bind cooperatively through contacts between their DNA binding domains (Chen et al., 1995; Durand et al., 1987; Durand et al., 1988; Fujita et al., 1986; Hoey et al., 1995; Jain et al., 1993; Rooney et al., 1995; Siebenlist et al., 1986). Mutation of key residues in the NFATc2 DNA binding domain that disrupt the interface required for cooperativity with AP-1 significantly reduces IL-2 transcription (Macian et al., 2000). A second layer of transcriptional synergy can result from promoter-bound activators interacting with other activators, coactivators, or the general transcription machinery (Carey, 1998). Less is known about how NFAT and AP-1 proteins modulate IL-2 transcription via this second layer of synergy.

Here we studied the ability of NFAT (NFATc2 and NFATc1) and AP-1 (cJun and cFos) proteins to synergistically activate transcription from the human IL-2 promoter. We found that in Jurkat cells, cJun and cFos occupy the IL-2 promoter prior to stimulation, whereas NFATc2 occupancy correlates with the onset of transcription after stimulation. We found that of these proteins only NFATc2 and cJun have the ability to synergistically activate IL-2 transcription. We discovered a unique interaction between the C-terminal region of NFATc2 and cJun that is required for this synergy. Overexpression of this region of NFATc2 blocked the synergistic activation of IL-2 transcription by NFATc2 and cJun. These studies reveal a new and specific interaction between two transcriptional activators that function to synergistically activate transcription during the response of T cells to co-stimulation.

2. Materials and methods

2.1. Plasmid construction, protein expression, and protein purification

The baculovirus constructs pVL-GST-NFATc2(DBD) (amino acids 391–583), pVL-GST-NFATc2, and pVL-HAX-NFATc2 have been previously described (Kim et al., 2000). pVL-HAX-NFATc1 was made by cloning the human NFATc1 cDNA (Hoey et al., 1995) into the NdeI and BamHI sites of pVL-HAX. The E. coli expression constructs pET-cJun, pGEX-cJun, pGEX-cFos and pGEX-NFATc2(688–921) have been previously described (Ferguson and Goodrich, 2001; Kim et al., 2001; Lively et al., 2001). pGEX-cJun(1–317) was created by digesting pGEX-cJun (full-length) with NcoI and HpaI, and the fragment was subsequently ligated into pGEX-2TKN digested with NcoI and StuI. The following constructs for generating 35S-labeled in vitro transcribed/translated proteins were previously described: pBS-KS+-NFATc2, pTβ-NFATc2(1–686), and pTβ-NFATc2(391–921) (Kim et al., 2001) pTβ-cJun and pTβ-NFATc2(391–686) were created by inserting the corresponding cDNA into pTβ-STOP (gift of R. Tjian) using the NdeI and EcoRI sites. To make plasmids pcDNA-HA-cJun(1–317), pcDNA-HA-cFos, pcDNA-HA-NFATc2, pcDNA-HA-NFATc1, pcDNA-HA-NFATc2(1–686), and pcDNA-HA-NFATc2(688–921), a cDNA encoding each protein was cloned into the NdeI and EcoRI sites of pcDNA-G4 (Thut et al, 1997). The pBS-IL2-Luciferase reporter (Ferguson et al., 2001; Weaver et al., 2007) and the pNFAT3-E1B-Luciferase reporter (Kim et al., 2001) have been previously described. The (NFAT/AP1)3-Luciferase reporter was a gift from R. Tjian.

Expression and purification of proteins from insect cells were performed as previously described (Kim et al., 2000). Expression and purification of proteins from E. coli were performed as previously described (Ferguson and Goodrich, 2001; Kim et al., 2001; Lively et al., 2001). The expression and purification of hsTAF4 has been described previously (Kim et al., 2001).

2.2. Protein-protein interaction assays

Interaction assays using recombinant proteins from bacteria, insect cells, and 35S-labeled in vitro transcribed/translated proteins were performed as previously described (Kim et al., 2001; Lively et al., 2001) with the addition of micrococcal nuclease treatment as described (Nguyen and Goodrich, 2006). In general, all immobilized proteins and soluble target protein solutions were incubated in the presence or absence of micrococcal nuclease for 10 min at 30°C prior to mixing, and then subsequently incubated together for 2 hr at 4°C.

2.3. Transfection assays

Jurkat cells were maintained in 5% CO2 at 37°C in RPMI containing 10% FBS, 100 U/ml Penicillin, 100 μg/ml Streptomycin, and 2 mM L-Glutamate. On the day of the transfection, Jurkat cells were seeded into 6-well plates (1×106 cells/well) in serum-free RPMI. Using the X-tremeGene Q2 transfection reagent (Roche), each well received 3.2 μl X-tremeGene in 80 μl OptiMEM combined with 80 μl DNA dilution buffer containing 1000 ng pBS-IL2-Luc, 250 ng pRL-null-Renilla-luciferase (Promega), 500 ng of each protein expression construct, and the amount of the parental pcDNA(+)3.1 vector required to keep the total amount of DNA transfected constant. Cells were left in serum-free RPMI for 5 hr at 37°C, after which an equal volume of RPMI containing 20% FBS was added. After an additional 19 hr incubation, cells were harvested in 1.5 ml microcentrifuge tubes and resuspended in 1 ml RPMI (10% FBS) with 1μM ionomycin, 20 ng/ml PMA, and 10 mM CaCl2. Cells were returned to fresh 6-well plates for 6 hr then harvested and lysed with 500 μl Passive Lysis Buffer (Promega). Firefly and Renilla luciferase activities were determined using the Dual-luciferase kit (Promega). Transfection efficiency was typically between 5–10%.

2.4. RT-PCR

For RT-PCR, RNA was extracted using Trizol Reagent (Invitrogen) and subsequently treated with DNase I (1–4 Units) at 37°C for 10 min, which was then heat inactivated. The RNA was added to reactions containing 5–6 μM of random decamer primer, 12 Units of RNA guard (Amersham Pharmacia), and Moloney Murine Leukemia Virus Reverse Transcriptase in 40 μl of RT buffer (25 mM KCl, 50 mM Tris (pH 7.5), 10 mM DTT, 3.5 mM MgCl2, 100 μg/ml BSA, and 0.5 mM of each dNTP). Reactions were incubated at 42°C for 1 hr, then heat inactivated at 95°C for 3 min. Parallel reactions were performed in the absence of reverse transcriptase. cDNA was then titrated into PCR reactions containing 0.5 μM each of the forward and reverse primers (see Table 1). Titrations of the cDNA into the PCR reactions were performed to ensure that signals were within the linear response range.

Table 1.

Primer sequences

Primer name Sequence 5′–3′
IL-2 promoter forward (ChIP) TCCAAAGAGTCATCAGAAGAGG
IL-2 promoter reverse (ChIP) GGCAGGAGTTGAGGTTACTGTG
IL-2 intron/exon forward (RT-PCR) CAACGTAATAGTTCTGGAAC
IL-2 intron/exon reverse (RT-PCR) GTAGGCTAATTACATGCATG
Open in a new tab

2.5. ChIP assays

Jurkat cells were stimulated with PMA and ionomycin as described above for the amounts of time shown in Fig. 1. Prior to harvesting, cells were treated with 1% formaldehyde for 5 min at room temperature with gentle shaking. Glycine was added to a final concentration of 0.125 M and the cells were incubated at room temperature for 5 min with gentle shaking. Cells were harvested in PBS. Nuclei were isolated by resuspending 7.5 million cells in 600 μl of buffer A (3 mM MgCl2, 10 mM Tris-HCl (pH 7.4), 10 mM NaCl, and 0.5% (v/v) NP-40) and incubating for 5 min on ice. Nuclei were harvested by centrifugation and washed once in an equal volume of buffer A. Nuclei were then resuspended in 200 μl of buffer B (50 mM Tris (pH 7.9), 10 mM EDTA, 0.2 mM PMSF, 1% SDS, and 1X protease inhibitors (Complete cocktail tablets, Roche)) and incubated on ice for 10 min. 300 μl of buffer C (15 mM Tris (pH 7.9), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.2 mM PMSF, protease inhibitors) was then added and samples were sonicated using a cup sonicator filled with ice water (five 1.5 min bursts at a setting of 4.5, with 1.75 min between bursts). After centrifugation the supernatants were diluted with buffer C to a final volume of 1.5 ml and stored in 100 μl aliquots.

Fig. 1.

Fig. 1

Open in a new tab

NFATc2 and cJun are unique in their ability to synergistically activate IL-2 transcription. (A) NFATc2 is present at the IL-2 promoter in Jurkat cells after 1 hr of co-stimulation when IL-2 pre-mRNA is first observed. Nuclear unspliced IL-2 mRNA was detected using RT-PCR (top panel). ChIP assays show the occupancy of NFATc2, NFATc1, cJun, and cFos at the IL-2 promoter (lower 6 panels). (B) NFATc2 and cJun activate an IL-2 reporter upon stimulation with PMA and ionomycin. For each sample, relative luciferase activity was calculated by dividing Firefly luciferase activity by Renilla luciferase activity. The data were normalized to the average relative activity obtained in the absence of over-expressed proteins and stimulation. Bars are the average of two measurements and error bars indicate the range of the two points. (C) NFATc2 and cJun synergistically activate transcription of the IL-2 reporter. The data were normalized to the average relative activity obtained in the absence of over-expressed proteins. Bars are the average of three measurements and error bars represent one standard deviation. (D) Fold synergy was calculated for the data in panel C by dividing the level of relative luciferase activity observed when the activators were expressed together by the sum of the relative luciferase activities observed with each activator expressed individually. The dashed line indicates the level expected in the absence of synergy (1.0). (E) NFATc2 and NFATc1 both activate expression from a synthetic promoter containing three NFAT sites upstream of a TATA box and the Firefly luciferase gene. Each bar is the average of three measurements and is normalized to the average relative activity obtained in the absence of over-expressed proteins. The error bars indicate one standard deviation.

For each immunoprecipitation, one 100 μl aliquot of sonicated chromatin was pre-cleared with 8 μl of protein A/G beads (Santa Cruz Biotechnology) that were equilibrated in buffer D (15 mM Tris (pH 7.9), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 0.2 mM PMSF, protease inhibitors). 4 μl of antibody against NFATc2 (sc7296; Santa Cruz Biotechnology), NFATc1 (sc7294; Santa Cruz Biotechnology), cJun (sc52; Santa Cruz Biotechnology), or cFos (sc45; Santa Cruz Biotechnology) was added and samples were nutated at 4°C overnight. 15 μl of pre-blocked protein A/G beads (pre-blocking occurred by nutating the beads overnight at 4°C in buffer D containing 2.5 mg/ml yeast RNA and 6 mg/ml BSA) were added and samples were nutated an additional 1–2 hr at 4°C. Beads were washed sequentially with 200 μl of low salt buffer (20 mM Tris (pH7.9), 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), 200 μl of high salt buffer (20 mM Tris (pH7.9), 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), 200 μl of LiCl buffer (10 mM Tris (pH7.9), 1 mM EDTA, 1% deoxycholate, 1% NP-40, 250 mM LiCl), and twice with 200 μl of TE (10 mM Tris(pH 7.9), 1 mM EDTA). 100 μl of elution buffer containing 1% SDS and 0.1 M NaHCO3 was added to the beads and the mixture was nutated for 15 min at room temperature. The beads were precipitated and the supernatant was transferred to a new tube. NaCl was added to 200 mM and crosslinks were reversed by incubation at 65°C for 4 hr. Samples were then treated with Proteinase K (10 μg) for 1 hr at 45°C. After phenol extraction and ethanol precipitation samples were resuspended in 50 μl TE with 50 mM KCl and subjected to PCR (see Table 1 for primer sequences).

3. Results

3.1. NFATc2 and cJun are unique in the ability to synergistically activate IL-2 transcription

To understand when different NFAT and AP-1 proteins occupy the IL-2 promoter relative to the appearance of the IL-2 transcript, we determined both the level of IL-2 pre-mRNA using RT-PCR and the occupancies of NFAT and AP-1 proteins at the IL-2 promoter using ChIP assays before and during a time course after co-stimulation of Jurkat cells (Fig. 1A). Unspliced IL-2 mRNA was detected in isolated nuclei 1 hr after Jurkat cells were co-stimulated, peaked at 6 hr, and decreased by 24 hr (top panel). cJun and cFos were detected at the promoter prior to co-stimulation and did not change substantially over the entire time course. NFATc2 was first detected at the promoter 1 hr after co-stimulation and peaked at the 6 hr time point, whereas NFATc1 was first detected after 6 hr of stimulation and peaked at the 15 hr time point. Finding cJun and cFos at the IL-2 promoter prior to stimulation suggests that the promoter is poised to respond to NFAT proteins once they become localized in the nucleus after stimulation. Moreover, the correlation between NFATc2 binding to the IL-2 promoter and the appearance of IL-2 transcripts suggests that NFATc2 triggers the initial activation of IL-2 transcription.

To begin to study the combinatorial contributions of different NFAT and AP-1 proteins to activation at the IL-2 promoter, we performed transient transfection assays in Jurkat cells using a reporter plasmid containing the −326 to +45 region of the human IL-2 promoter upstream of the Firefly luciferase gene. In the absence of over-expressed activators, a 10-fold increase in reporter activity was observed upon stimulation with PMA and ionomycin (Fig. 1B). Overexpression of NFATc2 and cJun caused an additional 20-fold increase in IL-2 reporter activity under stimulated conditions.

We used this reporter assay to systematically measure IL-2 activation by NFATc2, NFATc1, cFos, and cJun individually and in different combinations, always stimulating with PMA and ionomycin. As shown in Fig. 1C, when over-expressed individually, each of the activators modestly increased expression from the IL-2 reporter (1.6 to 3.8-fold activation). When different combinations of activators were co-expressed, the highest level of activity was observed with NFATc2 and cJun (18-fold activation). Indeed, this was the only combination of activators that caused synergistic activation: The combination of NFATc2 and cJun caused a 3-fold greater increase in reporter activity than the sum of the activities observed with the individual proteins (Fig. 1D). For all other combinations of NFAT and AP-1 proteins the luciferase activity was similar to or less than the sum of the activities observed with individual proteins. For example, co-expressing cFos along with cJun and NFATc2 eliminated synergistic activation. Moreover, expressing cJun with NFATc1, as opposed to NFATc2, did not result in synergistic activation, even though expression of the NFAT proteins caused a similar level of activation from a reporter containing multimerized NFAT binding sites (Fig. 1E). These results show that cJun and NFATc2 are unique in their ability to synergistically activate IL-2 transcription.

To ask whether the IL-2 promoter is programmed to respond synergistically to NFATc2 and cJun, we co-expressed combinations of NFATc2, cJun, and cFos with a reporter plasmid containing three NFAT/AP-1 composite elements (the ARRE-2 element from the IL-2 promoter) upstream of a TATA box and the luciferase gene. This reporter is dependent on both ionomycin and PMA for activation after transfection into Jurkat cells, similar to the IL-2 promoter (Fig. 2A). Over-expressed NFATc2 and cJun did not exhibit synergistic activation at this synthetic promoter (Fig. 2B); individually the two proteins enhanced transcription, but when combined synergy was not observed. We conclude that not only are NFATc2 and cJun unique in their ability to synergistically activate IL-2 transcription, but doing so requires the context of the natural IL-2 promoter.

Fig. 2.

Fig. 2

Open in a new tab

NFATc2 and cJun do not synergistically activate transcription from a synthetic promoter containing three NFAT/AP-1 composite sites. (A) Expression from the (NFAT/AP-1)3-Luciferase reporter in Jurkat cells requires co-stimulation with PMA and ionomycin. Each bar is the average of three measurements and is normalized to the average relative activity obtained in the absence of stimulation. The error bars represent one standard deviation. (B) NFATc2 and cJun do not synergistically activate transcription from the (NFAT/AP-1)3-Luciferase reporter in Jurkat cells. Each bar is the average of three measurements and is normalized to the average relative activity obtained in the absence of over-expressed protein. The error bars represent one standard deviation.

3.2. NFATc2 binds cJun in the absence of DNA

We hypothesized that the unique ability of NFATc2 and cJun to synergistically activate IL-2 transcription involves interactions between these proteins beyond the contacts that function in cooperative DNA binding. To test for interaction between NFATc2 and cJun off of DNA, we used in vitro pull-down assays with recombinant proteins. A common problem in this type of assay is that contaminating nucleic acids can mediate interaction between proteins. To control for this, we performed interaction assays with proteins treated with micrococcal nuclease to degrade any contaminating nucleic acids (Nguyen and Goodrich, 2006). GST-NFATc2, GST-NFATc2(DBD) (containing the minimal DNA binding domain), and control GST were immobilized and incubated with 35S-labeled cJun. In the absence of micrococcal nuclease, both full-length and the minimal DNA binding domain of NFATc2 bound cJun (Fig. 3A, lanes 2 and 3). Upon treatment with micrococcal nuclease, the DNA binding domain of NFATc2 no longer bound cJun (Fig. 3A, compare lanes 2 and 5). By contrast, full-length NFATc2 bound cJun even after nuclease treatment (Fig. 3A, compare lanes 3 and 6). This suggested that regions of NFATc2 outside of the minimal DNA binding domain directly interact with cJun off of DNA.

Fig. 3.

Fig. 3

Open in a new tab

NFATc2, but not NFATc1, interacts directly with cJun in the absence of DNA. (A) cJun can bind directly to full-length NFATc2 but not the minimal DNA binding domain of NFATc2. Immobilized full-length GST-NFATc2, GST-NFATc2(DBD), or control GST were incubated with 35S-labeled cJun in the absence or presence of micrococcal nuclease prior to mixing. Bound complexes were washed, resolved by SDS-PAGE and cJun was detected by autoradiography. (B) cJun binds NFATc2 but not NFATc1 in the absence of DNA. Immobilized GST-cJun(1–317) and control GST were incubated with HA-NFATc2 or HA-NFATc1, and bound protein was subjected to western analysis with α-HA antibody.

To investigate the specificity of the NFATc2 and cJun interaction and to determine whether a correlation exists between the ability to interact in the absence of DNA and synergistic transcriptional activation, we performed additional protein-protein interaction assays with highly purified proteins. We found that purified NFATc2 bound immobilized GST-cJun (Fig. 3B, lane 3), whereas NFATc1 did not (Fig. 3B, lane 6). Moreover, NFATc2 did not bind GST-cFos or GST-cFos/cJun (Fig. 4A). In addition, NFATc1 was unable to interact with either cFos or cFos/cJun (Fig. 4B). Hence, there is a strong correlation between the unique ability of NFATc2 and cJun to interact off of DNA and to synergistically activate IL-2 transcription.

Fig. 4.

Fig. 4

Open in a new tab

NFATc2 and cJun are unique in the ability to interact off of DNA. (A) NFATc2 does not bind cFos or cFos/cJun dimers. Immobilized GST-Fos, GST-cFos preloaded with cJun, GST-cJun, and control GST were incubated with HA-NFATc2. Bound protein was subjected to western analysis with α-HA and α-cJun antibodies. (B) NFATc1 does not bind cFos or cFos/cJun dimers. The experiment was identical to that in panel A except HA-NFATc1 was substituted for HA-NFATc2.

3.3. The C-terminal region of NFATc2 binds cJun and is required for synergistic IL-2 activation

We next wanted to identify the region of NFATc2 that interacts with cJun. The most notable difference between NFATc2 and NFATc1 is the absence of the C-terminal Q-rich activation region in NFATc1 (Fig. 5A). To test whether one or both termini of NFATc2 are necessary for interaction with cJun, GST-cJun(1–317) was immobilized and incubated with 35S-labeled NFATc2 deletion proteins. Truncation of the C-terminal region of NFATc2 reduced its ability to bind cJun (Fig. 5B, compare lanes 1 and 7), whereas truncation of the N-terminal region did not affect binding (Fig. 5B, compare lanes 1 and 4). Thus, the C-terminal region of NFATc2 is required for full interaction with cJun off of DNA.

Fig. 5.

Fig. 5

Open in a new tab

The C-terminal region of NFATc2 is required to both bind cJun in the absence of DNA and synergistically activate IL-2 transcription. (A) Comparison of NFATc2 and NFATc1 highlights similarities and differences between the two proteins. The proteins are highly similar in two regions: the NFAT homology region (NHR) and the conserved DNA binding domain. The primary difference is that NFATc1 lacks the C-terminal Q-rich activation domain. (B) The C-terminal region of NFATc2 is required for maximal interaction with cJun. Immobilized GST-cJun(1–317) and control GST were incubated with 35S-labeled NFATc2 deletion mutants, and bound protein was subjected to SDS-PAGE and analyzed by phosphorimagery. (C) The C-terminal region of NFATc2 is required for synergistic activation of IL-2 luciferase expression. Bars are the average of three measurements and error bars represent one standard deviation.

To determine whether the C-terminal region of NFATc2 was necessary for synergistic activation of IL-2 transcription, we performed transfection experiments in Jurkat cells with a mutant NFATc2 lacking the C-terminal region, NFATc2(1–686). In this experiment, we observed that cJun and full-length NFATc2 synergistically activated the IL-2 reporter, as expected (Fig. 5C). Truncation of the C-terminal region of NFATc2 reduced activation and attenuated the observed synergy. Indeed, deletion of the C-terminal region caused NFATc2 to behave similarly to NFATc1. Taken together, the data in Fig. 5 show that the C-terminal region of NFATc2, which binds cJun, is required to synergistically activate transcription from the IL-2 promoter.

We previously showed that hsTAF4 (hTAFII130) served as a coactivator for NFATc2, and that the C-terminal activation domain of NFATc2 bound hsTAF4 (Kim et al., 2001). Since cJun binds this same region of NFATc2 we asked whether NFATc2 bound to cJun could simultaneously interact with hsTAF4. To test this, GST-cJun(1–317) was immobilized and sequentially incubated with purified HA-NFATc2 and then hsTAF4. hsTAF4 bound the cJun/NFATc2 complex, but not cJun alone (Fig. 6, compare lanes 2 and 4). Hence, NFATc2 was able to bridge hsTAF4 to the immobilized cJun. This shows that NFATc2 can simultaneously bind cJun and hsTAF4.

Fig. 6.

Fig. 6

Open in a new tab

cJun and hsTAF4 can simultaneously bind NFATc2. Immobilized GST-cJun(1–317) and control GST were incubated with buffer or NFATc2. The beads were washed, incubated with hsTAF4, and bound complexes were subjected to western analysis with α-HA and α-hsTAF4 antibodies.

3.4. Expression of an NFATc2 C-terminal peptide specifically represses IL-2 transcription in T cells

We next tested whether the C-terminal region of NFATc2 was sufficient to interact with cJun. GST-NFATc2(688–921) was immobilized and incubated with purified cJun. cJun bound GST-NFATc2(688–921), although the level of bound cJun was lower than with GST-NFATc2 (Fig. 7A, compare lanes 1 and 3). Hence, the region of NFATc2 from 688–921 is both necessary and minimally sufficient to bind cJun off of DNA. We asked whether overexpression of this region of NFATc2 would affect synergistic activation of the IL-2 reporter in Jurkat cells. The C-terminal region of NFATc2 (NFATc2(688–921)) was over-expressed in Jurkat cells alone and with different combinations of NFATc2, NFATc1, NFATc2(1–686), and cJun. Strikingly, NFATc2(688–921) caused a 5-fold reduction in synergistic activation by cJun and NFATc2 (Fig. 7B). Importantly, this inhibition was specific, because NFATc2(688–921) did not appreciably affect reporter activity when either NFATc1 or NFATc2(1–686) was co-expressed with cJun. Hence, the unique synergy observed between NFATc2 and cJun at the IL-2 promoter is specifically repressed by overexpression of the C-terminal region of NFATc2.

Fig. 7.

Fig. 7

Open in a new tab

The C-terminal region of NFATc2 is sufficient to bind cJun and blocks IL-2 transcription when over-expressed. (A) The C-terminal region of NFATc2 is sufficient to bind cJun. GST-NFATc2(688–921) (purified from E. coli), GST-NFATc2 (purified from insect cells) and control GST (purified from both E. coli and insect cells) were immobilized. Immobilized protein and purified cJun were incubated, and bound cJun was detected by western analysis with α-cJun antibody. (B) Overexpression of the C-terminal region of NFATc2 represses synergistic IL-2 activation. Bars are the average of three measurements and error bars represent one standard deviation.

4. Discussion

We investigated the roles of NFAT and AP-1 proteins in synergistically activating human IL-2 transcription. NFATc2 and cJun co-occupied the endogenous IL-2 promoter at the onset of transcription, and also synergistically activated an IL-2 reporter when over-expressed in Jurkat T cells. Other combinations of over-expressed NFATc2, NFATc1, cJun, and cFos were unable to synergistically activate the IL-2 reporter. Insight into the molecular mechanism of synergistic activation by NFATc2 and cJun came from protein-protein interaction assays, which revealed that in the absence of DNA, NFATc2 binds directly to cJun. The C-terminal activation domain of NFATc2 (amino acids 688–921) was necessary and sufficient to bind cJun and was required for synergistic activation of IL-2 transcription. This same region of NFATc2 was previously shown to bind the coactivator hsTAF4 (Kim et al., 2001), and here we found that NFATc2 can simultaneously bind cJun and hsTAF4. Overexpression of NFATc2(688–921) dominantly repressed synergistic activation by NFATc2 and cJun. Our studies show that NFATc2 and cJun synergistically activate IL-2 transcription upon T cell co-stimulation via a previously unidentified protein-protein interaction.

Finding that the combination of NFATc2 and cJun/cJun can synergistically activate IL-2 transcription, while other combinations of NFAT and AP-1 proteins cannot (e.g. NFATc1-cJun/cJun, NFATc2-cFos/cJun, and NFATc1-cFos/cJun) was surprising. All four of these combinations of NFAT and AP-1 proteins are known to bind DNA cooperatively at composite elements in the IL-2 promoter via contacts between their conserved DNA binding domains (Chen et al., 1998; Hoey et al., 1995; Ramirez-Carrozzi and Kerppola, 2003). If synergistic activation of IL-2 transcription resulted only from cooperative DNA binding then all of these combinations would be expected to cause synergy. When protein-protein interaction assays were performed under conditions where contaminating nucleic acid was eliminated, a specific interaction between NFATc2 and cJun was revealed. Consistent with the inability of other combinations of NFAT and AP-1 proteins to synergistically activate IL-2 transcription, NFATc2 did not bind cFos/cJun and NFATc1 bound neither cJun/cJun nor cFos/cJun in the absence of DNA. Hence, there is a strong correlation between the unique ability of NFATc2 and cJun to synergistically activate IL-2 transcription and the specificity of interaction between NFAT and AP-1 proteins in the absence of DNA. These observations are consistent with a model in which synergy can result from highly specific protein-protein interactions between DNA bound transcriptional activators.

The specificity of synergistic transcriptional activation by NFATc2 and cJun extends to the IL-2 promoter itself. NFATc2 and cJun where unable to synergistically activate transcription from a synthetic promoter containing 3 copies of an NFAT/AP-1 composite site. Together these observations indicate that the synergy observed between NFATc2 and cJun occurs after cooperative DNA binding and involves yet to be defined properties of the IL-2 promoter. It is possible that the C-terminal domain of an NFATc2 that is bound to an element in the IL-2 promoter interacts with cJun/cJun bound at another location in the promoter. This assembly could then recruit other factors, such as coactivators or the general transcription machinery.

The observations that cJun is present at the IL-2 promoter in Jurkat cells prior to stimulation and NFATc2 associates with the IL-2 promoter at the onset of transcription indicate that binding of NFATc2 triggers the initial transcriptional activation of the endogenous IL-2 gene. As NFATc1 levels increase over time in stimulated T cells (Lyakh et al., 1997; Timmerman et al., 1997), it also occupies the IL-2 promoter. At this point IL-2 pre-mRNA levels no longer increase and ultimately decline; it is possible that the presence of NFATc1 causes this decrease by disrupting synergy between NFATc2 and cJun/cJun. It has also been shown that NFATc2 activates NFATc1 expression (Zhou et al., 2002). This suggests a feedback mechanism where NFATc2 contributes to a high level of synergistic IL-2 transcription immediately upon T cell stimulation, but also activates transcription of the NFATc1 gene, which ultimately leads to a decrease in ongoing IL-2 transcription.

Overexpression of the C-terminal region of NFATc2 repressed the synergistic activation of IL-2 transcription seen with cJun and NFATc2. We conclude that this repression was specific for synergy for two reasons. First, when the C-terminal region of NFATc2 was over-expressed in the presence of NFATc2 and cJun, it decreased IL-2 reporter activity to a level equal to the sum of the effects of NFATc2 and cJun alone (i.e. it abolished the synergy). Second, overexpression of the C-terminal region of NFATc2 did not repress the non-synergistic activation caused by cJun and NFATc1. Since the C-terminal region of NFATc2 (amino acids 688–921) is a transcriptional activation domain (Luo et al., 1996), and we have previously found this region to activate transcription by contacting the coactivator hsTAF4 (Kim et al., 2001), it would not have been surprising if expression of NFATc2(688–921) stimulated cJun activated transcription. Perhaps, in the context of the IL-2 promoter, the recruitment of yet one more activation domain contributes little to stimulating transcription. Instead, the binding of the NFATc2(688–921) peptide to cJun/cJun at the IL-2 promoter likely represses synergy by blocking interaction between promoter-bound cJun/cJun and NFATc2.

Acknowledgments

We thank R. Freiman and R. Tjian for providing the (NFAT/AP1)3-Luciferase reporter plasmid. This research was supported by Public Health Service Grant R01 GM55235 from the National Institute of General Medical Sciences. T.N.N. was supported in part by NIH Predoctoral Training Grant T32 GM08759. R.D.W. was supported in part by NIH Predoctoral Training Grant T32 GM08759. T.N.L. was supported in part by NIH Predoctoral Training Grant T32 GM07135.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abbas AK, Lichtman AH. Cellular and Molecular Immunology. 5. W.B. Saunders Company; Philadelphia, PA: 2005. [Google Scholar]
  2. Avni O, Rao A. T cell differentiation: a mechanistic view. Curr Opin Immunol. 2000;12:654–659. doi: 10.1016/s0952-7915(00)00158-8. [DOI] [PubMed] [Google Scholar]
  3. Carey M. The enhanceosome and transcriptional synergy. Cell. 1998;92:5–8. doi: 10.1016/s0092-8674(00)80893-4. [DOI] [PubMed] [Google Scholar]
  4. Carey M, Lin YS, Green MR, Ptashne M. A mechanism of synergistic activation of a mammalian gene by GAL4 derivatives. Nature. 1990;345:361–364. doi: 10.1038/345361a0. [DOI] [PubMed] [Google Scholar]
  5. Chen L, Glover JN, Hogan PG, Rao A, Harrison SC. Structure of the DNA-binding domains from NFAT, Fos and Jun bound specifically to DNA. Nature. 1998;392:42–48. doi: 10.1038/32100. [DOI] [PubMed] [Google Scholar]
  6. Chen L, Oakley MG, Glover JN, Jain J, Dervan PB, Hogan PG, Rao A, Verdine GL. Only one of the two DNA-bound orientations of AP-1 found in solution cooperates with NFATp. Curr Biol. 1995;5:882–889. doi: 10.1016/s0960-9822(95)00178-3. [DOI] [PubMed] [Google Scholar]
  7. Chinenov Y, Kerppola TK. Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene. 2001;20:2438–2452. doi: 10.1038/sj.onc.1204385. [DOI] [PubMed] [Google Scholar]
  8. Durand DB, Bush MR, Morgan JG, Weiss A, Crabtree GR. A 275-basepair fragment at the 5′ end of the interleukin 2 gene enhances expression from a heterologous promoter in response to signals from the T-cell antigen receptor. J Exp Med. 1987;165:395–407. doi: 10.1084/jem.165.2.395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Durand DB, Shaw JP, Bush MR, Replogle RE, Belagaje R, Crabtree GR. Characterization of antigen receptor response elements within the interleukin-2 enhancer. Mol Cell Biol. 1988;8:1715–1724. doi: 10.1128/mcb.8.4.1715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ferguson HA, Goodrich JA. Expression and purification of recombinant human c-Fos/c-Jun that is highly active in DNA binding and transcriptional activation in vitro. Nucleic Acids Res. 2001;29:E98. doi: 10.1093/nar/29.20.e98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ferguson HA, Kugel JF, Goodrich JA. Kinetic and mechanistic analysis of the RNA polymerase II transcription reaction at the human interleukin-2 promoter. J Mol Biol. 2001;314:993–1006. doi: 10.1006/jmbi.2000.5215. [DOI] [PubMed] [Google Scholar]
  12. Flanagan WM, Crabtree GR. In vitro transcription faithfully reflecting T-cell activation requirements. J Biol Chem. 1992;267:399–406. [PubMed] [Google Scholar]
  13. Fujita T, Shibuya H, Ohashi T, Yamanishi K, Taniguchi T. Regulation of human interleukin-2 gene: functional DNA sequences in the 5′ flanking region for the gene expression in activated T lymphocytes. Cell. 1986;46:401–405. doi: 10.1016/0092-8674(86)90660-4. [DOI] [PubMed] [Google Scholar]
  14. Han K, Levine MS, Manley JL. Synergistic activation and repression of transcription by Drosophila homeobox proteins. Cell. 1989;56:573–583. doi: 10.1016/0092-8674(89)90580-1. [DOI] [PubMed] [Google Scholar]
  15. Hoey T, Sun YL, Williamson K, Xu X. Isolation of two new members of the NF-AT gene family and functional characterization of the NF-AT proteins. Immunity. 1995;2:461–472. doi: 10.1016/1074-7613(95)90027-6. [DOI] [PubMed] [Google Scholar]
  16. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev. 2003;17:2205–2232. doi: 10.1101/gad.1102703. [DOI] [PubMed] [Google Scholar]
  17. Jain J, McCaffrey PG, Miner Z, Kerppola TK, Lambert JN, Verdine GL, Curran T, Rao A. The T cell transcription factor NFATp is a substrate for calcineurin and interacts with the DNA-binding domains of Fos and Jun. Nature. 1993;365:352–355. doi: 10.1038/365352a0. [DOI] [PubMed] [Google Scholar]
  18. Jain J, McCaffrey PG, Valge-Archer VE, Rao A. Nuclear factor of activated T cells contains Fos and Jun. Nature. 1992;356:801–804. doi: 10.1038/356801a0. [DOI] [PubMed] [Google Scholar]
  19. Kim LJ, Ferguson HA, Seto AG, Goodrich JA. Characterization of DNA binding, transcriptional activation, and regulated nuclear association of recombinant human NFATp. BMC Immunol. 2000;1:1. doi: 10.1186/1471-2172-1-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim LJ, Seto AG, Nguyen TN, Goodrich JA. Human TAF(II)130 is a coactivator for NFATp. Mol Cell Biol. 2001;21:3503–3513. doi: 10.1128/MCB.21.10.3503-3513.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lin YS, Carey M, Ptashne M, Green MR. How different eukaryotic transcriptional activators can cooperate promiscuously. Nature. 1990;345:359–361. doi: 10.1038/345359a0. [DOI] [PubMed] [Google Scholar]
  22. Lin YS, Carey MF, Ptashne M, Green MR. GAL4 derivatives function alone and synergistically with mammalian activators in vitro. Cell. 1988;54:659–664. doi: 10.1016/s0092-8674(88)80010-2. [DOI] [PubMed] [Google Scholar]
  23. Lively TN, Ferguson HA, Galasinski SK, Seto AG, Goodrich JA. c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro. J Biol Chem. 2001;276:25582–25588. doi: 10.1074/jbc.M100278200. [DOI] [PubMed] [Google Scholar]
  24. Loh C, Carew JA, Kim J, Hogan PG, Rao A. T-cell receptor stimulation elicits an early phase of activation and a later phase of deactivation of the transcription factor NFATc2. Mol Cell Biol. 1996;16:3945–3954. doi: 10.1128/mcb.16.7.3945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Luo C, Burgeon E, Rao A. Mechanisms of transactivation by nuclear factor of activated T cells-1. J Exp Med. 1996;184:141–147. doi: 10.1084/jem.184.1.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lyakh L, Ghosh P, Rice NR. Expression of NFAT-family proteins in normal human T cells. Mol Cell Biol. 1997;17:2475–2484. doi: 10.1128/mcb.17.5.2475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Macian F. NFAT proteins: key regulators of T-cell development and function. Nat Rev Immunol. 2005;5:472–484. doi: 10.1038/nri1632. [DOI] [PubMed] [Google Scholar]
  28. Macian F, Garcia-Rodriguez C, Rao A. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J. 2000;19:4783–4795. doi: 10.1093/emboj/19.17.4783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McGuire KL, Iacobelli M. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 response element/AP-1 sequence in human T cells. J Immunol. 1997;159:1319–1327. [PubMed] [Google Scholar]
  30. Nguyen TN, Goodrich JA. Protein-protein interaction assays: eliminating false positive interactions. Nat Methods. 2006;3:135–139. doi: 10.1038/nmeth0206-135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Peterson BR, Sun LJ, Verdine GL. A critical arginine residue mediates cooperativity in the contact interface between transcription factors NFAT and AP-1. Proc Natl Acad Sci USA. 1996;93:13671–13676. doi: 10.1073/pnas.93.24.13671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ramirez-Carrozzi V, Kerppola T. Asymmetric recognition of nonconsensus AP-1 sites by Fos-Jun and Jun-Jun influences transcriptional cooperativity with NFATc2. Mol Cell Biol. 2003;23:1737–1749. doi: 10.1128/MCB.23.5.1737-1749.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ransone LJ, Visvader J, Sassone-Corsi P, Verma IM. Fos-Jun interaction: mutational analysis of the leucine zipper domain of both proteins. Genes Dev. 1989;3:770–781. doi: 10.1101/gad.3.6.770. [DOI] [PubMed] [Google Scholar]
  34. Rao A, Avni O. Molecular aspects of T-cell differentiation. Br Med Bull. 2000;56:969–684. doi: 10.1258/0007142001903634. [DOI] [PubMed] [Google Scholar]
  35. Rooney JW, Sun YL, Glimcher LH, Hoey T. Novel NFAT sites that mediate activation of the interleukin-2 promoter in response to T-cell receptor stimulation. Mol Cell Biol. 1995;15:6299–6310. doi: 10.1128/mcb.15.11.6299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Siebenlist U, Durand DB, Bressler P, Holbrook CA, Norris M, Kamoun M, Kant JA, Crabtree GR. The promoter region of the interleukin-2 gene undergoes chromatin structure changes and confers inducibility on chloramphenicol acetyltransferase gene during activation of T cells. Mol Cell Biol. 1986;6:3042–3049. doi: 10.1128/mcb.6.9.3042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Timmerman LA, Clipstone NA, Ho SN, Northrop JP, Crabtree GR. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature. 1996;383:837–840. doi: 10.1038/383837a0. [DOI] [PubMed] [Google Scholar]
  38. Timmerman LA, Healy JI, Ho SN, Chen L, Goodnow CC, Crabtree GR. Redundant expression but selective utilization of nuclear factor of activated T cells family members. J Immunol. 1997;159:2735–2740. [PubMed] [Google Scholar]
  39. Turner R, Tjian R. Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers. Science. 1989;243:1689–1694. doi: 10.1126/science.2494701. [DOI] [PubMed] [Google Scholar]
  40. Weaver JR, Good K, Walters RD, Kugel JF, Goodrich JA. Characterization of the sequence and architectural constraints of the regulatory and core regions of the human interleukin-2 promoter. Mol Immunol. 2007;44:2813–2819. doi: 10.1016/j.molimm.2007.01.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zhou B, Cron RQ, Wu B, Genin A, Wang Z, Liu S, Robson P, Baldwin HS. Regulation of the murine Nfatc1 gene by NFATc2. J Biol Chem. 2002;277:10704–10711. doi: 10.1074/jbc.M107068200. [DOI] [PubMed] [Google Scholar]

RESOURCES