Skip to main content
. 2010 Jun 25;76(16):5500–5509. doi: 10.1128/AEM.00691-10

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Genotype or relevant characteristicsb Source and/or reference
E. coli strains
    TOP10 (both chemically competent and electrocompetent) FmcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG Invitrogen (catalog no. C4040-10 and C4040-50)
    α-Select (Bronze efficiency) FdeoR endA1 recA1 relA1 gyrA96 hsdR17(rkmk+) phoA supE44 thi-1 Δ(lacZYA-argF)U169 φ80δlacZΔM15 λ Bioline
    GM272 FfhuA2 or fhuA31, lacY1 or lacZ4, tsx-1 or tsx-78, glnV44(AS) galK2(Oc) λ− dcm-6 dam-3 mtlA2 metB1 thi-1? hsdS21 CGSCa (no. 6478); 17
D. vulgaris strains
    ATCC 29579 WT D. vulgaris Hildenborough ATCC
    JW801 WT ΔpDV1 37
    JW9021 WT Δ(qmoABC-DVU0851) Kmr This study
    JW9063 WT ΔDVU0851 Kmr This study
Plasmids
    pCR8/GW/TOPO TOPO cloning vector; Spr Invitrogen
    pCR-XL-TOPO TOPO cloning vector; Kmr Invitrogen
    pSC27 Desulfovibrio shuttle vector; source of aph(3)-II; Kmr 34
    pMO719 pCR8/GW/TOPO containing SRB replicon (pBG1); Spr 18
    pMO9020 pCR8/GW/TOPO with 977 bp upstream and 951 bp downstream of aph(3)-II cassette to delete qmoABC-DVU0851; Spr Kmr This study
    pMO9021 pCR-XL-TOPO containing aph(3)-IIp::qmoABC-DVU0851; Kmr This study
    pMO9040 pMO719 with aph(3)-IIp::qmoABC; Spr This study
    pMO9042 pMO719 with aph(3)-IIp::qmoABC-DVU0851; Spr This study
    pMO9062 pCR8/GW/TOPO with 964 bp upstream and 951 bp downstream of aph(3)-II cassette to delete DVU0851; Kmr Spr This study
    pMO9070 pCR8/GW/TOPO; Kmr Spr This study
    pMO9071 pMO719 with aph(3)-II; Kmr Spr This study
    pMO9072 pMO719 with aph(3)-IIp and MCS; Spr; for complementation constructs This study
    pMO9074 pMO9072 with DVU0851 in MCS; Spr This study
    pMO9116 pMO9040 with aph(3)-IIp::RBS::qmoABC; Spr This study
    pMO9117 pMO9042 with aph(3)-IIp::RBS::qmoABC-DVU0851; Spr This study
    pMO9118 pMO9074 with aph(3)-IIp::RBS::DVU0851; Spr This study
a

CGSC, Coli Genetic Stock Center.

b

WT, wild type; aph(3)-IIp, promoter from kanamycin resistance gene aph(3)-II; MCS, multicloning site; RBS, ribosomal binding site (TGCAGTCCCAGGAGGTACCAT).