TABLE 1.
Strain or plasmid | Genotype or relevant characteristicsb | Source and/or reference |
---|---|---|
E. coli strains | ||
TOP10 (both chemically competent and electrocompetent) | F−mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG | Invitrogen (catalog no. C4040-10 and C4040-50) |
α-Select (Bronze efficiency) | F−deoR endA1 recA1 relA1 gyrA96 hsdR17(rk−mk+) phoA supE44 thi-1 Δ(lacZYA-argF)U169 φ80δlacZΔM15 λ− | Bioline |
GM272 | F−fhuA2 or fhuA31, lacY1 or lacZ4, tsx-1 or tsx-78, glnV44(AS) galK2(Oc) λ− dcm-6 dam-3 mtlA2 metB1 thi-1? hsdS21 | CGSCa (no. 6478); 17 |
D. vulgaris strains | ||
ATCC 29579 | WT D. vulgaris Hildenborough | ATCC |
JW801 | WT ΔpDV1 | 37 |
JW9021 | WT Δ(qmoABC-DVU0851) Kmr | This study |
JW9063 | WT ΔDVU0851 Kmr | This study |
Plasmids | ||
pCR8/GW/TOPO | TOPO cloning vector; Spr | Invitrogen |
pCR-XL-TOPO | TOPO cloning vector; Kmr | Invitrogen |
pSC27 | Desulfovibrio shuttle vector; source of aph(3′)-II; Kmr | 34 |
pMO719 | pCR8/GW/TOPO containing SRB replicon (pBG1); Spr | 18 |
pMO9020 | pCR8/GW/TOPO with 977 bp upstream and 951 bp downstream of aph(3′)-II cassette to delete qmoABC-DVU0851; Spr Kmr | This study |
pMO9021 | pCR-XL-TOPO containing aph(3′)-IIp::qmoABC-DVU0851; Kmr | This study |
pMO9040 | pMO719 with aph(3′)-IIp::qmoABC; Spr | This study |
pMO9042 | pMO719 with aph(3′)-IIp::qmoABC-DVU0851; Spr | This study |
pMO9062 | pCR8/GW/TOPO with 964 bp upstream and 951 bp downstream of aph(3′)-II cassette to delete DVU0851; Kmr Spr | This study |
pMO9070 | pCR8/GW/TOPO; Kmr Spr | This study |
pMO9071 | pMO719 with aph(3′)-II; Kmr Spr | This study |
pMO9072 | pMO719 with aph(3′)-IIp and MCS; Spr; for complementation constructs | This study |
pMO9074 | pMO9072 with DVU0851 in MCS; Spr | This study |
pMO9116 | pMO9040 with aph(3′)-IIp::RBS::qmoABC; Spr | This study |
pMO9117 | pMO9042 with aph(3′)-IIp::RBS::qmoABC-DVU0851; Spr | This study |
pMO9118 | pMO9074 with aph(3′)-IIp::RBS::DVU0851; Spr | This study |
CGSC, Coli Genetic Stock Center.
WT, wild type; aph(3′)-IIp, promoter from kanamycin resistance gene aph(3′)-II; MCS, multicloning site; RBS, ribosomal binding site (TGCAGTCCCAGGAGGTACCAT).