Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2010 Jul 28;61(13):3599–3613. doi: 10.1093/jxb/erq173

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© 2010 The Author(s).

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)

PMC Copyright notice

Fig. 2. — GbML1 binds to the L1 box in vitro. (A) Interaction of GbML1 protein with the L1 box. 1–3: Controls provided by the kit. 1, No protein, biotin-ENBL probe; 2, ENBL, biotin-ENBL probe; 3, ENBL, biotin-ENBL probe and 100× ENBL cold competitor. 4–6, binding assay for GbML1;. 4, MBP, biotin-L1 probe (L1: TGTAAATGCACCTGCAACACA); 5, GbML1, biotin-L1 probe; 6, GbML1, biotin ml1 probe (mL1:TGTAAGGGCACCTGCAACACA). (B) Reduced probe concentration results in weaker binding. 2, 2×dilution; 3, 4×dilution; 4, 8× dilution. (C) HD-ZLZ domains are required and sufficient for binding to the L1 box. Binding reaction includes biotin-labelled L1 box probe with different MBP fusion proteins: 1, MBP protein; 2, MBP-GbML1 protein; 3, MBP-HD protein; 4, MBP-HD-ZLZ protein; 5, MBP-START–SAD protein. (D) Point mutations in the third helix affect the binding of HD-ZLZ to L1 box. Left: Diagram of the point mutation and proteins used in EMSA. Right, EMSA assay. The number above is correlated to the number of the proteins diagramed. (E) GbML1 binds to the L1 box containing promoters from cotton. (F) ZLZ domain confers homodimer formation. left: Diagram of different constructs used for the yeast two-hybrid assay; right, yeasts harbouring BD-GbML1/AD-HD or BD-GbML1/AD-ZLZ grown on selective plates as indicated. Control medium: –2 (SD/-T-L); selective medium: –3 (SD/-T-L-H), 10 mM (–3 supplemented with 10 mM 3-AT), –4 (SD/-T-L-H-A). The control is yeast transformed with BD-GbML1/AD.