Table 1. Flanking sequences of integration sites of OX3860 into Aedes albopictus.

Strain	5′ Flanking sequence		3′ Flanking sequence
OX3860A	n.d.	ttaa	tcaactcaacgtacatatgta
OX3860B	gcgcacaagcttagaggtact	ttaa	tccaagcagacaaccgaaatg
OX3860C	cctgacgtgactagataaccc	ttaa	ggaatgagtaactcttggtag
OX3860D	tttactaacacaaaattagta	ttaa	cgtcattcgttttgcagaaga
OX3860F	cttccatgtagattgtttcgt	ttaa	acgtccgtgaaatagtatcgc

Genomic sequences immediately flanking the piggyBac insertions of OX3860 lines were obtained by inverse PCR. All the insertion sites were unique and occurred at a TTAA site, the canonical recognition sequence for the piggyBac transposable element. n.d.: not determined. The 5′ inverse PCR for the OX3860A line was not successful but the 3′ flanking sequence is sufficient to prove the independence of the A insertion. Full flanking sequences are provided in Table S2.