Table 1. Flanking sequences of integration sites of OX3860 into Aedes albopictus.
Strain | 5′ Flanking sequence | 3′ Flanking sequence | |
OX3860A | n.d. | ttaa | tcaactcaacgtacatatgta |
OX3860B | gcgcacaagcttagaggtact | ttaa | tccaagcagacaaccgaaatg |
OX3860C | cctgacgtgactagataaccc | ttaa | ggaatgagtaactcttggtag |
OX3860D | tttactaacacaaaattagta | ttaa | cgtcattcgttttgcagaaga |
OX3860F | cttccatgtagattgtttcgt | ttaa | acgtccgtgaaatagtatcgc |
Genomic sequences immediately flanking the piggyBac insertions of OX3860 lines were obtained by inverse PCR. All the insertion sites were unique and occurred at a TTAA site, the canonical recognition sequence for the piggyBac transposable element. n.d.: not determined. The 5′ inverse PCR for the OX3860A line was not successful but the 3′ flanking sequence is sufficient to prove the independence of the A insertion. Full flanking sequences are provided in Table S2.