Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of primers and probes
| Gene (GenBank ID) | Primer/Probe | Sequence (5' to 3') |
|---|---|---|
| ApoM (AF118393.3) | Forward primer | tgccccggaaatggatcta |
| Reverse primer | cagggcggccttcagtt | |
| Probe | FAM-cacctgactgaagggagcacagatctca-TAMRA | |
| GAPDH (AF261085.1) | Forward primer | ggaaggtgaaggtcggagtc |
| Reverse primer | cgttctcagccttgacggt | |
| Probe | FAM-tttggtcgtattgggcgcctg-TAMRA |
