TABLE 1.
Bacterial strains, primers, and genetic constructs used in this study
Bacterial strains, constructs, and primers | Catalog no., sequence, or description | Reference |
---|---|---|
Strains | ||
Gordonia sp. | ||
KTR9 | 51 | |
KTR9/pGKT2-1Δ | KTR9 strain with 182-kb plasmid cured | This study |
KTR9/pGKT2-2Δ | KTR9 strain with 182-kb plasmid cured | This study |
Rhodococcus jostii RHA1 | 46a | |
Escherichia coli BL21(DE3) | Stratagene 200131 | |
Plasmid constructs | ||
pEMTXplA | 1,668-bp fragment representing xplA from KTR9 synthesized into pET11a | This study |
pEMT-Cyp151C | 1,197-bp fragment representing a cytochrome P450 from KTR9 synthesized into pET11a | This study |
pTpXplA | xplA cloned into pTip vector | This study |
pKTR9-gntR | 3-kb flanking region of gntR from KTR9 synthesized into pCR2.1 and subcloned into BamHI site of pK18mobsacB | This study |
pKTR9-xplA | 3-kb flanking region of xplA from KTR9 synthesized into pCR2.1 and subcloned into BamHI site of pK18mobsacB | This study |
Primers | ||
Real-time PCR | ||
xplaFm2239 | 5′GATGACCGCTGCGTCCATCGAT3′ | This study |
xplaR2333 | 5′CCTGTTGCAGTCGCCTATACC3′ | This study |
xplR518F | 5′CAGAGATGTGCCGGATGCT3′ | This study |
xplR568R | 5′CGGTCACCGTGCTCATCAC3′ | This study |
Cyp151C678F | 5′TGATGAGCTGCGTGATGTGA3′ | This study |
Cyp151C728R | 5′GTGTCGTATCCGCCGAAGAT3′ | This study |
Glutamine68F | 5′TCGACGCGATCAAGCAGTAC3′ | This study |
Glutamine11R | 5′TCACGGCCTGGAAGTCGACG3′ | This study |
xplB175F | 5′CAGGGCACGAAGAACGTGAT3′ | This study |
xplB225R | 5′CCGATCGTCGAATACCCG3′ | This study |
Miscellaneous | ||
xplRF | 5′TGAGTGACGCCATCACGATC3′ | This study |
xplRR | 5′TCTCTGCCTGAAGAGTGACC3′ | This study |
xplAF | 5′GAACCCGAGAATCACCCGAACACC3′ | This study |
xplAR | 5′AGGAAACCGCAGGAAAGAC3′ | This study |
182plasmid_gapF(gln-xplB) | 5′AGGTCGAACTCAACTGGATG3′ | This study |
182plasmid_gapR(gln-xplB) | 5′AGTCCGATCGTCGAATACCC3′ | This study |
ktr9plas120565aF | 5′CGAAGGGCTTCTCACTTCAC3′ | This study |
ktr9plas121248aR | 5′GACGAGACCTCCTTGCAGAC3′ | This study |
ktr9plas149923bF | 5′TGGCGAACTGAGACCTTCTT3′ | This study |
ktr9plas150701bR | 5′GCATTCTGTCCTTGCTGTCA3′ | This study |