Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
In-Situ hybridization primers
| Name | NCBI mRNA LOCUS | Direction | Sequence | Product length | Exon | Species |
|---|---|---|---|---|---|---|
| OMP | NM_006189 | Forward | cctgacctcaccaacctcat | 223 | 1 | Homo sapiens |
| Reverse | gctggttaaaaaccacggag | 1 | ||||
| OcNc1 | NM_012928 | Forward | agttccgaaaggtcagcaaa | 305 | 7 | Rattus norvegicus |
| (CNGA2) | Reverse | cttgccctccttgatgatgt | 7 | |||
| OR3A1 | NM_002550 | Forward | cagaatctggggccaatg | 308 | 1 | Homo sapiens |
| Reverse | gatggcactctgcacatcag | 1 | ||||
| OR1A1 | NM_014565 | Forward | tgagggaaaataaccagtcc | 249 | 1 | Homo sapiens |
| Reverse | ttgttgaagagtttccgcag | 1 | ||||
