Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer Sets for Semi-quantitative and Quantitative RT-PCR
| Gene | Primer Name | Exons | Sequence (5′-3′) | Size | Temp°C |
|---|---|---|---|---|---|
| DSPP | RT mDSPP-S | 4/5 | agcatgtccttctgggaaga | 208 bp | 60 |
| DSPP | RT mDSPP-AS | 4/5 | actgtgggcagctgatttct | 60 | |
| DMP-1 | RT mDMP-1-S | 5/6 | aggaatcgcatcccaatatg | 221 bp | 60 |
| DMP-1 | RT mDMP-1-AS | 5/6 | gctgtgcgtgtggtcactat | 60 | |
| NMA/BAMBI | NMA-S | 2/3 | cgcaatggatcgccactcc | 500 bp | 60 |
| NMA/BAMBI | NMA-AS | 2/3 | cgcaatggatcgccactcc | 60 | |
| GAPDH | GAPDH-S | 5/7 | caaagttgtcatggatgacc | 407 bp | 60 |
| GAPDH | GAPDH-AS | 5/7 | ccatggagaaggctgggg | 60 |
