Table 2. List of genes selected for Anopheles gambiae mosquito age grading.
Gene/Probe ID | qRT-PCR primerForward primer (5′-3′)Reverse primer (5′-3′) | Size | Age effect* | Blood feeding effect† | Functional assignment | Fold changes‡ | Correlation coefficient¶ |
AGAP009551 | TGCCGATTAAGATTCCCAAC TTCAAGGAGTTCCTGCTCGT | 83bp | ↑ | no | Sulfotransferase domain | 4.2 | 0.89 |
AGAP011615 | GTCTTCCAACCGGAGGTACA CTCCTCTGGACCGGATGTTA | 81bp | ↑ | no | Chitin binding Peritrophin-A domain | 3.28 | 0.61 |
AGAP002827 | ATTGGAGCGTACGCGGTTA CCAGCTAGCAGCAATCCGTA | 83bp | ↑ | no | Synaptic vesicle membrane | 3.49 | 0.50 |
AGAP005501 | ACGTGATCGACACGAATCTG GCACACCACTGTTACCGATG | 285bp | ↓ | no | Rossmann-fold NAD(P)(+)-binding proteins | −3.95 | 0.65 |
ENSANGT00000015027 | GTCATCTTCTCGCGGTTAGC CAGTCCAAGCGTGGTATCCT | 185bp | ↓ | no | Actin activities | −5.37 | 0.93 |
AGAP009790 | TCCTAGTGCTCGTCAGTGTGA GTTCGCCGGTTTAGCTCATA | 82bp | ↓ | no | Chitin binding Peritrophin-A domain | −4.66 | 0.52 |
AGAP007963 | GATGCCACCCTTCTTGTTGT AATTCAAACAGGCCGTCAAG | 239bp | ↓ | no | EF-hand, calcium binding motif | −4.33 | 0.66 |
*Age effect: “↑” and “↓” indicate gene expression monotonically increases decreases with age.
Blood feeding effect: “no” stands for no significant effect of blood feeding on gene expression.
Fold changes: variation in transcript accumulation between 1-day and 28-day old female mosquitoes, regardless of blood their feeding diet calculated from microarray data.
¶Correlation coefficient: Spearman correlation between gene expression values and mosquito ages in laboratory colonized mosquitoes.