Table 3.
OSD genomic primers and expected PCR product sizes, designed to identify affected, carrier and normal dogs for COL9A2 and COL9A3 mutations.
| # | Forward primer name | Forward primer sequence | Reverse primer name | Reverse primer sequence | Expected size in wt | Expected size in carrier | Expected size in affected |
|---|---|---|---|---|---|---|---|
| 1 | COL9A2_Part11F | gctgaccttgtggattttctcc | COL9A2intron1R | gtgaatgggcaccattgtct | 1,445 bp | 178 bp | 178 bp |
| 2 | COL9A2_Part10F | catctctccctcactccctcct | COL9A2_Part10R | tcacccctctcccagtctcttag | 504 bp | 504 bp | No band |
| 3 | COL9A3test1F | gctgccactgggctcctttcttcg | COL9A3test1R | agcaggagcagggccagcgtg | 248 bp | 248 bp and 249 bp | 249 bp |